BIO 12 DNA DOUBLE HELIX.
Hi, I'm having troubles understanding the following question(s) and was wondering if anyone could give me a hand?
Original DNA Double Helix:
TACGGGATACCGCCGTTCACACGT ( Starting From Left; Position #1 would be between the first A and T, Position #2 would be between the second and third C, Position #3 would be between the fourth G and lastly, position #4 would be on the fifth C.
Top Strand = ATG || CCC || TAT || GGC || GGC || CAA || GTG || TGCU ||
Bottom Strand = AUG || CCC || UAU || GGC || GGC || UGU || GCU ||
3. What peptide would be produced if an extra thymine were accidentally inserted into the DNA strand at position #1?
5. What sequence of amino acids would be produced if the nucleotide at position #3 was somehow substituted by cytosine?
5. What sequence of amino acids would be produced if the nucleotide at position #3 was somehow substituted by cytosine?
Thank you very much for your time and consideration! :D
Sure! I'd be happy to help you understand and answer these questions step by step.
3. To determine the effect of an extra thymine inserted at position #1, we need to translate the DNA sequence into RNA and then into amino acids. Let's first transcribe the DNA sequence to RNA. Remember that DNA uses T (thymine) and RNA uses U (uracil):
Original DNA sequence: TACGGGATACCGCCGTTCACACGT
Transcribed RNA sequence: AUGCCCUAUGGCUGGCAAGUGUGC
Now, we can divide the transcribed RNA sequence into codons, which are groups of three nucleotides that code for a specific amino acid:
Codons: AUG | CCC | UAU | GGC | UGG | CAA | GUG | UGC
Using the table for the genetic code, we can find the corresponding amino acids for each codon:
AUG - Methionine (Met)
CCC - Proline (Pro)
UAU - Tyrosine (Tyr)
GGC - Glycine (Gly)
UGG - Tryptophan (Trp)
CAA - Glutamine (Gln)
GUG - Valine (Val)
UGC - Cysteine (Cys)
Therefore, if an extra thymine were accidentally inserted at position #1, the resulting peptide would be: Methionine-Proline-Tyrosine-Glycine-Tryptophan-Glutamine-Valine-Cysteine.
5. To determine the effect of substituting the nucleotide at position #3 with cytosine, we will again transcribe the DNA sequence into RNA and then translate it into amino acids.
Original DNA sequence: TACGGGATACCGCCGTTCACACGT
Transcribed RNA sequence: AUGCCCUAUGGCUGGCAAGUGUGC
Now, let's focus on the codon at position #3, which is the third codon in the transcribed RNA sequence:
Original codon at position #3: UAU (Tyrosine)
Substituted codon at position #3: UAC (Tyrosine)
The substitution of the nucleotide did not change the amino acid, so the resulting sequence of amino acids would be the same as before:
Methionine-Proline-Tyrosine-Glycine-Tryptophan-Glutamine-Valine-Cysteine.
I hope this helps! Let me know if you have any further questions.
To answer the questions, we need to understand the relation between DNA, RNA, and proteins. DNA consists of nucleotides, which are made up of a sugar-phosphate backbone and a nitrogenous base. There are four bases in DNA: adenine (A), thymine (T), cytosine (C), and guanine (G).
1. To determine the effect of an extra thymine (T) inserted at position #1, we need to transcribe the DNA into RNA. During transcription, thymine in DNA is replaced by uracil (U) in the RNA. So, the top strand "ATG" would become "AUG" in RNA. Now, we can translate the RNA into amino acids using the genetic code. AUG codes for the amino acid methionine (Met). Therefore, if an extra thymine is inserted at position #1, the peptide produced would start with methionine.
2. Similarly, to determine the effect of substituting cytosine (C) for the nucleotide at position #3, we need to transcribe and translate the DNA. The sequence "TAT" in the top strand would become "UAU" in RNA. UAUCodes for the amino acid tyrosine (Tyr). Therefore, if cytosine is substituted for the nucleotide at position #3, the sequence of amino acids produced would start with tyrosine.
Note: Questions 2 and 3 are the same, so I have provided the explanation only once.
I hope this helps! Let me know if you have any further questions.