Biology

posted by .

Please help! i was wondering why a genome size determined in a lab would be smaller than that of the actual.

thanks

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Biology

    I really need help with my science lab. I was sick when we did the lab on Thursday and Friday was a snowday so I did not get to get the observations off my peers. My teacher has allowed people one more day and I do not understand this …
  2. Biology Lab gr 12

    hi, i did this lab, from this website and I was wondering if anyone could come up with 3 sources of error, and they can't be human error. Thanks! You are saving me! Seeing as I am not allowed to post to the website :(, search on google …
  3. Labs: Biology 12

    Question: hi, i did this lab, from this website and I was wondering if anyone could come up with 3 sources of error, and they can't be human error. Thanks! You are saving me! Seeing as I am not allowed to post to the website :(, search …
  4. Ms. Sue Help me, please

    Hello, I was wondering if it was possible for you to assist me in having a science/biology teacher answer my question. It is called 12 Biology and I reposted as Biology Lab Banana DNA. My reason for this is that so many questions keep …
  5. biology

    You have isolated the genome from a novel virus and would like to determine its composition. you have three tubes, each containing one of these substance: 1. a protein that degrades double stranded DNA (DNase, tube 1) 2. a protein …
  6. Algebra 1

    1.Simplify the expression below (-2w^3)^5 / 8w. What is the value of the exponent on "w" ?
  7. Biochemistry

    Please help! i was wondering why a genome size determined in a lab would be smaller than that of the actual. thanks
  8. Biology

    Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC …
  9. biology

    A bacterium has a genome size of 6.0 X 106 base pairs. There is one Origin of Replication (ORI) and each DNA polymerase catalyzes the addition of 1,000 nucleotides/second. How much time is needed to replicate the entire genome?
  10. Biology

    Why can viruses of the family of the Poxviridae be genetically modified more easily than viruses of most other viral families?

More Similar Questions