Biochemistry

posted by .

Please help! i was wondering why a genome size determined in a lab would be smaller than that of the actual.

thanks

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Biology Lab gr 12

    hi, i did this lab, from this website and I was wondering if anyone could come up with 3 sources of error, and they can't be human error. Thanks! You are saving me! Seeing as I am not allowed to post to the website :(, search on google …
  2. Labs: Biology 12

    Question: hi, i did this lab, from this website and I was wondering if anyone could come up with 3 sources of error, and they can't be human error. Thanks! You are saving me! Seeing as I am not allowed to post to the website :(, search …
  3. PLEASE RESPOND!!

    Question: hi, i did this lab, from this website and I was wondering if anyone could come up with 3 sources of error, and they can't be human error. Thanks! You are saving me! Seeing as I am not allowed to post to the website :(, search …
  4. biology

    You have isolated the genome from a novel virus and would like to determine its composition. you have three tubes, each containing one of these substance: 1. a protein that degrades double stranded DNA (DNase, tube 1) 2. a protein …
  5. chemistry

    How would the 2s and 3p orbitals differ from the 1s and 2p orbitals?
  6. Chemistry

    I did a lab today in class and part of the lab is to experimentally find the enthalpy for the dissolution of ammonium chloride by dissolving 4.0 g of NH4Cl(s) in 50.0 mL of H2O(l). I got a -5°C temperature change and calculated delta …
  7. Algebra 1

    1.Simplify the expression below (-2w^3)^5 / 8w. What is the value of the exponent on "w" ?
  8. Biology

    Please help! i was wondering why a genome size determined in a lab would be smaller than that of the actual. thanks
  9. Biology

    Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC …
  10. biology

    A bacterium has a genome size of 6.0 X 106 base pairs. There is one Origin of Replication (ORI) and each DNA polymerase catalyzes the addition of 1,000 nucleotides/second. How much time is needed to replicate the entire genome?

More Similar Questions