Biology

posted by .

How are antibodies used to detect similarities in protein sequences?

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Bio

    Insulin, antibodies, enzymes and progesterone are four of many molecules found in and around cells. Of these four__________ are/is not a protein. (Points: 4) a. antibodies b. insulin and antibodies c. antibodies and progesterone d. …
  2. BioChem

    Please help with this question. Insulin, antibodies, enzymes and progesterone are four of many molecules found in and around cells. Of these four__________ are/is not a protein. a. antibodies b. insulin and antibodies c. antibodies …
  3. Calculus

    fter a foreign substance is introduced into the blood, the rate at which antibodies are made is modeled by f(t) = 27 t/8 t^2 + 3 where f(t) is in thousands of antibodies per minute, and t is measured in minutes with 0 ≤ t ≤ …
  4. Molecular Biology

    You are working in a lab that has recently discovered a new viral protein. Describe in detail how you could generate a polyclonal antibody preparation against this protein. Include a full description of production and purification. …
  5. Biology

    When making comparison of sequences where some are whole genome sequences while others are partial genome sequences, or a specific glycoprotein sequence, How is it that we are able to make comparisons from these sequences if they all …
  6. Biology

    why do we use protein sequences when comparing genetic similarities?
  7. Biology

    For each of the following characteristics, will the migration of the protein speed up, slow down, or remain unchanged if you do not add SDS?
  8. science/biology (cladogram)

    How would a scientist use DNA or protein sequences from three different organisms to construct a cladogram?
  9. Biology Help Please!

    )Describe the importance of chromatin remodeling process to transcription. Select the four correct answers. a) These alterations can be used to activate transcription of a gene by hiding its enhancer sequences. b) These alterations …
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions