Post a New Question

Biology

posted by .

why do we use protein sequences when comparing genetic similarities?

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Biology

    Humans and Gorillas are very similar in terms of their genetic sequences; in a sample of each of their DNA sequences, only ONE difference was found. MY QUESTION: What genetic mechanism could cause this base sequence change?
  2. Biology

    How are scientists able to piece together the process of protein synthesis and the effects of genetic controls without direct observation?
  3. Biology

    Part 1: Genetics – From Genes to Proteins, Mutations (Chapter 10) Overview: Genetic information in DNA is transcribed to RNA and then translated into the amino acid sequence of a Protein. A) Step 1 - Transcription: During the process …
  4. Biology

    10. Most of the time, genetic characters are inherited by more complex patterns of heredity including all of the following EXCEPT a. solitary alleles b. incomplete dominance c. codominance d. polygenic inheritance A?
  5. Biology

    When making comparison of sequences where some are whole genome sequences while others are partial genome sequences, or a specific glycoprotein sequence, How is it that we are able to make comparisons from these sequences if they all …
  6. Biology

    How are antibodies used to detect similarities in protein sequences?
  7. biology

    An individual with the genetic condition cystic fibrosis has CFTR protein with the amino acid histidine (at position 482), where the normal CFTR protein has arginine. (No other changes are observed in the protein.) This is the result …
  8. Biology

    MEIOSIS 1)name the process unique to meiosis that occurs during bivalent formation that may increase genetic diversity?
  9. science/biology (cladogram)

    How would a scientist use DNA or protein sequences from three different organisms to construct a cladogram?
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions

Post a New Question