Science Fossils

posted by .

When might preserved remains of an entire organism form?

A. When sediment buries the hard part of an organism. (this one)

B. When an event such as quick burial or freezing preserves an entire organism.

C. When minerals replace parts of an organism.

D. When a thin layer of carbon is left on a rock.

  • Science Fossils -

    I disagree.

  • Science Fossils -

    Right.

    Think of mummies and the Ice Man.

  • Science Fossils -

    So it would be B

  • Science Fossils -

    I say B because it's what happened with the dinosaurs

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. 5th grade

    a new organism is found that is multicellular, does not have a backbone, and has six legs. while studying the organism, you notice that it develops somewhat like a grasshopper. explain how you would classify this organism, and discuss …
  2. science

    If waste products of an aquatic single celled organism were released by the organism into the pond, how would that affect the organism’s ability to obtain oxygen from the pond water?
  3. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  4. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  5. Science

    How does eye location beast represent the relationship between sturcture and function?
  6. Science

    Which statement is true of an organ system?
  7. science plz help fast

    how do mutualism and parasitism compare ?
  8. Science

    1.) when might preserved remains of an entire organism form?
  9. science PLEASE CHECK MY ANSWERS

    1. why is it rare for the soft parts of an organism to become a fossil a. the soft parts take a long time to decay. b. the soft parts can be eaten by other animas. c. The soft parts cannot be buried in sediment.>>>my answer …
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions