Biology

posted by .

true or false if an organism randomly develops a feature that gives it a survival advantage, then it will be more likely to survive than other organisms, and will also be more likely to produce offspring which also have this advantageous feature. Eventually, many organisms will have the feature.

  • Biology -

    True.

  • Biology -

    Thank you

  • Biology -

    A root hair is a small extentsion of an epidermal or outermosy cell layerof a dicot root

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. social studies (check plz)

    (which of the following is not part of part of the theory of evolution?
  2. Science! URGENT

    How might sexual reproduction decrease an organisms chance of survival?
  3. Science

    1. How might sexual reproduction decrease an organism’s chance of survival?
  4. science

    If you could double check my answer that would be awesome :) which of the following is not part of the theory of evolution?
  5. Science

    Which of the following is not a characteristic of natural selection?
  6. Science

    Ms. Sue PLEASE check my answers! 1. Which of the following is not part of the theory of evolution?
  7. SCIENCE HELP PLZ HELP PLZ

    Which is one advantage of sexual reproduction?
  8. science

    1. In plants, sexual reproduction occurs when sperm and egg unite to form a... a. gamete b. gametophyte c. sporophyte d. zygote Is it d?
  9. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions