science

posted by .

whats a change of dna in an organism?

  • science -

    Mutation?

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Bio...DNA

    Can anyone explain the relationship between the structure of DNA , protein structure and phenotype of an organism?
  2. science

    traits and how they change 1 natural selection 2 alleles 3 phenotype 4 evolution 5 DNA 6 genes 7 mutation an organism's______________ is determined by its GENOTYPE which is coded in ________________ located in ________________ of which …
  3. science -Do you think DNA from another organism wo

    Do you think DNA from another organism would have a different appearance?
  4. Science

    A change of the DNA in an organism that results in a new trait is known as?
  5. science

    (a) Investigators often remove blood from a crime scene in order to extract DNA for forensics. Although blood cells do contain nucleic acids, why would blood yield relatively less DNA than semen containing sperm cells?
  6. Science

    Darwin assumed that evolutionary change was always slow and gradual. What was the first evidence that suggested evolutionary change might happen fast sometimes?
  7. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  8. science

    1.Darwin assumed that evolutionary change was always slow and gradual. What was the first evidence that suggested evolution change might happen fast sometimes?
  9. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …
  10. Biology help needed bad!

    A biologist discovers a new unicellular organism and classifies it as a prokaryote. The cell is very small, contains a cell membrane, a cytoplasm, DNA in a nucleus, and no other cell organelles. Which statement below represents a correct …

More Similar Questions