Environmental Science

posted by .

7. Which of the following terms is used to describe a linear sequence in which energy is transferred from one organism to the next as each organism eats another organism?
a. trophic level
b. food web
c. energy pyramid
d. food chain
D

10. Which of the following is an example of ecological succession?
a. a planted shrub growing on a patio
b. mosses covering the floor of an old building
c. a tomato planted in a garden
d. none of the above
Either B or D..

21. Humans affect marine ecosystems by which of the following?
a. overfishing
b. oil spills
c. pesticides
d. all of the above
A

27. The tundra is most suitable to a vertebrate that
a. requires nesting sites in tall trees
b. is cold blooded
c. has a green outer skin for camouflage
d. can migrate hundreds of kilometers each summer
Either B or D..

Thanks
-MC
d.

  • math -

    okay

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Environmental Science

    What organism is likely to be in the bottom trophic level of a food chain?
  2. Biology

    Which organism is a third-order heterotroph?
  3. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  4. Environmental Science

    7. Which of the following terms is used to describe a linear sequence in which energy is transferred from one organism to the next as each organism eats another organism?
  5. Science Fossils

    When might preserved remains of an entire organism form?
  6. Science! Biology 1

    Question: Which of following best describes the free-energy requirements of an organism?
  7. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  8. Biology

    What is true of the energy that is passed from one trophic level to the next in a food chain?
  9. Science

    1.) when might preserved remains of an entire organism form?
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions