Biology

posted by .

which of the following DNA sequences would likely be the most stable? (only one strand of the helix is shown)

A) CCGAGGCCT
B) CGTATAGGG
C) CCCGGGGCC
D) CTAAGCTTT
E) ATATATATA

I know the answer is c but why is that true?

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Biology

    14. The major components of a DNA molecular subunit are a. a chromosome, deoxyribose, and double helix b. a five-carbon sugar, phosphate group, and a nitrogen-containing base c. adenine, guanine, cytosine, and thymine d. all of the …
  2. Biology

    14. The major components of a DNA molecular subunit are a. a chromosome, deoxyribose, and double helix b. a five-carbon sugar, phosphate group, and a nitrogen-containing base c. adenine, guanine, cytosine, and thymine d. all of the …
  3. Biology

    Kay so these are the strands of DNA 5' C C A G T A G T T 3' 3' G G T C A T C A A 5' Let's say the DNA molecule above were the parent strand of DNA. when the strands are split for replication, which strand would be the template for …
  4. Physics

    Stretching DNA. With its double-helix structure, DNA is coiled like a spring. A biophysicist grabs the ends of a DNA strand with optical tweezers and stretches it 26┬Ám producing 1.2pN- tension in the strand. What's the DNA's spring …
  5. Biology

    Does it matter which strand is the 'code strand'?
  6. BIO 12

    BIO 12 DNA DOUBLE HELIX. Hi, I'm having troubles understanding the following question(s) and was wondering if anyone could give me a hand?
  7. chemistry

    The total mass of DNA in the body is 50.0 g. If the number of nucleotides in ONE STRAND of DNA is approximately 3.0 x 106, and the average length of a single nucleotide is 0.34 nm, what is the length (in km) of one strand of DNA when …
  8. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …
  9. biology

    Are the DNA template strand and the mRNA sequences similar, or complementary?
  10. Biology

    16. During DNA replication, all of the following steps occur EXCEPT a. enzymes proofread new strands for errors and correct them b. the double helix is unwound by DNA polymerases c. base-pairing rules determine which nucleotide is …

More Similar Questions