Post a New Question

Biology

posted by .

Locate a diagram of an organism with the main organs and structures labeled.

Locate a diagram of an organism with the main organs and structures labeled.

Briefly explain how the organism in the diagram has evolved physiologically to become suited to its enviroment

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. numerical & proportional reasoning

    students in a biology class measured and recorded the lengths of different microscopic organisms. the results are recorded below. organism lenght(millimeters) a 0.00065 b 4.72* 10(exponent -4) c 8/10,000 d ?
  2. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  3. organism physiology paper

    explain how an organism has evolved physiologically to become suited to its environments. give examples.
  4. college

    explain how the organism in a diagram has evolved physiologically to become suited to its environeme
  5. bio 101

    how the organism in the diagram has evolved physiologically to become suited to its environmen
  6. biology

    draw a diagram that shows the chromosome combinations that are possible in the haploid gametes of an organism with a diploid number of 6
  7. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  8. Biology (CHECK)

    Describe how comparing the anatomy of living species provides evidence of evolution. A: Comparisons of the anatomy of different types of organisms often reveal basic similarities in body structures even though the structure's functions …
  9. science help PLS

    Examine the following diagram. Place the labeled layers in order from youngest to oldest. Diagram showing a section of rock strata. The bottommost layer is labeled 'A'; the layer directly on top of layer A is labeled 'B'; the layer …
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions

Post a New Question