biology

posted by .

Someone has just given you the cDNA for GFP and you would like to design a construct that would result in GFP becoming resident within the ER. What would you do to this cDNA that would result in this final location. Explain.

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Biology

    Can proteins like GFP slow transcription of other essential cellular proteins?
  2. English

    I I met my favorite singer on the street, _____________________ 1. I would would ask his autograph. 2. I would ask him to sign in my notebook. 3. I would like to have pictures taken with him. 4. I would just smile at him. 5. I would …
  3. biology

    To produce human protein X in bacterial cells, the plasmid (vector) that is chosen should have a _______________ promoter, and the source DNA should be ___________________. Which of the following best completes the sentence above?
  4. biology

    The sequence below begins with the initiator methione. ATGTTCAATGTTATGGATTGGCCCTGGTAAATGAAATAGAATGAT Please give a hypothetical (translation of cDNA sequence into single amino acid codes if there is a C deletion in the phenylalanine …
  5. biology

    Substance X is converted to substance Y in a chemical reaction. What role would a catalyst play in this scenario?
  6. Chemistry-check answer please

    I am given a question where I have to state which combination of electrodes will result in the greatest voltage and which will result in the lowest voltage. The metals given are Zinc, Copper, Silver and Hydrogen I think that silver …
  7. Physics

    I can't figure out how to do this. design an experiment you could construct that might measure the amount of work it takes to change the volume of a gas in a piston. What materials would you use?
  8. Biology

    Substance X is converted to substance Y in a chemical reaction. What role would a catalyst play in this scenario?
  9. Biology Help Please!

    1) A transcriptional fusion of regulatory sequences of a particular gene with a reporter gene results in relatively uniform expression of the reporter gene in all cells of an organism, whereas a translational fusion with the same gene …
  10. Chemistry

    In a titration experiment what would be the result on the concentration of the analyte if the drop counter did not count all the drops?

More Similar Questions