Post a New Question

ecology

posted by .

If you were trying to decide if an unknown organism is an archaebacterium or an eubactrium, you woul look at the ribosomes because?

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Bio

    What are some human activities which might cause oxygen levels in the atmosphere to drop dramatically?
  2. Biology

    -Rank the following terms from simplest to most complex: cells, organelles, organs, tissue, organism. -If a cell is like a school, then the nucleus would be...?
  3. BIOLOGY

    From your knowledge of the size and density of cell components and the process of centrifugation, predict the order (from first to last) that the nucleus and organelles will be extracted?
  4. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  5. ecology

    the word habitat has a hidden organism in the word what is it
  6. ecology

    Which organism belongs to a species that is likely to undergo genetic changes in shortest period of time?
  7. Ecology

    Find the name of an organism hiding in the word habitat
  8. Chemistry

    Lab: Titration of NaOH (0.1 molar)to unknown solid acid. Trying to determine the equilivent weight of the unknown acid in the experiement. I am trying to figure out if I add too much base solution by accident to an unknown acid during …
  9. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions

Post a New Question