Questions LLC
Login
or
Sign Up
Ask a New Question
Biology
Microbiology
Taxonomy/Classification
If you were trying to decide if an unknown organism is an archaebacterium or an eubactrium, you woul look at the ribosomes because?
1 answer
if you were decide if an unknown organism is an archaebacterium or aeubacterium you wold look at the ribosomrs brcause
You can
ask a new question
or
answer this question
.
Similar Questions
Unknown Organism
•Nucleus present •Mitochondria present •Multicellular •Cells grow in columns. •Cell wall made of
Top answer:
Fungi
Read more.
unknown organism|
*nucleus present *mitochondria present *multicellular *cells grow in columns *cell wall made of chitin
Top answer:
Fungi
Read more.
Chart of unknown organisms -nucleus present -mitochondria present -multicellular -cells grown in columns -cell walls made
Top answer:
It is most likely to belong to the kingdom Fungi. Fungi are multicellular organisms with nuclei and
Read more.
This chart shows observations made of an unknown organism. Based on this information the organism most likely belongs to
Top answer:
Protista.
Read more.
Unknown organism
• Nucleus present • Mitochondria present • Multicellular • Cells grow in columns • Cell wall made of
Top answer:
• Fungi The presence of a cell wall made of chitin, the ability to decompose organic matter, and
Read more.
This chart shows observations made of an unknown organism. Based on this information the organism most likely belongs to
Top answer:
Most likely, the organism belongs to the kingdom Plantae, based on the presence of cellulose in its
Read more.
A scientist discovered a microscopic, unicellular organism with no nucleus. Which of the following correctly describes the
Top answer:
Lesson 3:Science 6B Mini Module Test Unit 4 1:C 2:D 3:C 4:B 5:C 6:D 7:abiotic 8:Do you’re self
Read more.
Which statement describes a consumer/producer relationship?
A. One organism eats another organism that makes its own food B one
Top answer:
C. Both organisms benefit from each other
Read more.
Which statement describes a consumer/producer relationship?(1 point)
Responses One organism catches and consumes another
Top answer:
One organism that benefits from living in or on another organism at the expense of that organism.
Read more.
A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following
Top answer:
so the answer is A.
Read more.
Related Questions
A student uses a microscope to study a unicellular organism. He sees that the organism has extended a pseudopod. What is the
A) Your teacher describes an organism that digests its food externally before absorbing it. You also find out that this organism
Which statement describes a consumer producer relationship? A1 organism eats another organism that makes its own food be one
Which statement describes a consumer/producer relationship?(1 point)Responses
1.One organism catches and consumes another
A scientist is trying to classify a new organism. She observes that the organism is a microorganism. It is prokaryotic, and
A scientist is trying to classify a new organism. She observes that the organism is a microorganism. It is prokaryotic, and
A builder pushes
a wheelbarrow loaded with sand ,from rest at point A,up a ramp of unknown length ,which is inclined at unknown
Your teacher describes an organism that digests its food externally before absorbing it. You also find out that this organism
Which statement describes a consumer/producer relationship?
Both organisms benefit from each other. One organism that benefits
Here are parts of the DNA base sequences for 7 organisms:
Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2:
