biology

posted by .

explain how mitosis helps an organism to grow.

  • biology -

    How else can it increase the number of cells in the body?

  • biology -

    Idfk dumbass do u got damn research

  • biology -

    an example of how mitosis helps maintain complex organisms

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. biology

    Are an organism's characteristics determined only by its genes?
  2. life science

    Explanation of why the process of mitosis and meiosis are both important to a living organism. When would an organism need to undergo the process of mitosis?
  3. Science

    why is the process of mitosis and meiosis important to a living organism?
  4. Science

    why is the process of mitosis and meiosis important to a living organism?
  5. numerical & proportional reasoning

    students in a biology class measured and recorded the lengths of different microscopic organisms. the results are recorded below. organism lenght(millimeters) a 0.00065 b 4.72* 10(exponent -4) c 8/10,000 d ?
  6. Bilogy

    explain why the process of mitosis and meiosis are both important to living organisms. When would an organism need to undergo the process of mitosis?
  7. Biology

    In class I had to make an organism and explain how it adapts to it's imaginary environment. We have to explain the amount of food of eats everyday too. my teacher said that Theres a 10% rule to follow but I don't know what it is. Can …
  8. biology

    why is the process of mitosis and meiosis both important to living organism?
  9. biology

    when would and organism need to undergo the process of mitosis and meiosis?
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions