Biology

posted by .

What 'EXPERIMENT' did Craig Venter & Francis Collins do in the Human Genome Project?

Any links would be great! I've found a lot of info. on what it is, but I'm looking for info on what they did to get there.

  • Biology -

    Try this link and see if it helps you any. the human genome project in google.

  • Biology -

    Here are some sites that students can not post:

    http://www.jiskha.com/display.cgi?id=1303250515

    Sra

  • Biology -

    It only brought me back up to this page.

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. history (GB television)

    Hi, I am doing a project on when British television channels were launched, e.g. BBC1, BBC2, ITV1, Channel 4 and Channel 5 (then satellite channels). The kind of info I have found is BBC1 is oldest channel, BBB2 launched in 1964. Can …
  2. Business

    Where would I go to find info about finding info about the organizing function of management as it pertains to Technology and Human Resources?
  3. Biology

    I need to know this info about the Jack tailed Jackrabbit Originated: Invaded: Displacing: Steps to control them: if you could tell me the info or give me a site that would be great!
  4. Stars and the Galaxies

    if alpha centauri were to all of a sudden disappear, we wouldn't knknow 4 another 4.3 years. How come?
  5. Allied Health

    Of the following types of information, which one has the stictest rules regarding the release of information?
  6. Functions - more info

    Sorry, I forgot to enter all the info before. Below is the updated info for the problem. What's the best way to solve functions?
  7. English to Writeacher

    Yes, I know how to write a thesis statement and how a comparison essay goes.. But I already have my info: This is a comparison essay exploring to what degree an inherent film is discussed and how it relates to an aspect of the HUMAN …
  8. Biology

    Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC …
  9. psychology

    i need 2 examples of what researchers on the human genome project have already learned a bout the human genome
  10. English-The Giver (book)

    Can someone please give me soome info about the character The Giver?

More Similar Questions