Science

posted by .

A new organism is found that is multicellular, does not have a backbone, and has six legs. How would you classify this organism?

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. BIOLOGY

    IS A PLANT CELL AN EXAMPLE OF A UNICELLULAR ORGANISM?
  2. 5th grade

    a new organism is found that is multicellular, does not have a backbone, and has six legs. while studying the organism, you notice that it develops somewhat like a grasshopper. explain how you would classify this organism, and discuss …
  3. science

    If waste products of an aquatic single celled organism were released by the organism into the pond, how would that affect the organism’s ability to obtain oxygen from the pond water?
  4. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  5. 5th grade

    A new organism if found that is multicellular, does not have a backbone, and has six legs. It looks like a grasshopper. Classify this organism in two ways.
  6. Science

    A new organism is found that is multicellular, does not have a backbone and has six legs. Classfy this organism in two ways.
  7. Biology

    You find an unusual organism growing on the bark of a dying tree. Under a microscope, you observe that its cells are eukaryotic, have cell walls, and do not contain chloroplasts. Into what kingdom would you classify this organism?
  8. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  9. Science

    1.) when might preserved remains of an entire organism form?
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions