Biology

posted by .

You are given the following protein sequence: NH2-Met-Trp-Trp-Met-Trp-Met-COOH What was the sequence of the mRNA? You must write your answer 5' to 3' direction, starting with the first nucleotide of the mRNA and ending with the last nucleotide of the mRNA. DO NOT INCLUDE "5'-" or "3'-"; in your answer. Only write the nucleotide sequence. (You may use uppercase or lowercase for your answer).

  • Biology -

    AUGUGGUGGAUGUGGAUG

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Biology

    The human gene for the production of lactose is on chromosome 2. The dna nucleotide sequence of a small part from the middle is 123456789 TACTCGGAA I haVeTO WRITe DOWN THE EQVIVALENT SEQUENCE FOR MRNA AND HENCE WORK out the sequence …
  2. Biology

    pair up your nucleoide sequence with the mRNA sequence then you will find from the amino acids in the codons what amino acids are present in the lactase production. Each dna sequence coincincids with the appropriate mRNA sequence unless …
  3. biology

    DNA codes for mRNA, which is then translated into polypeptides,which are strands of amino acids. The DNA sequence below codes for the following amino acids: methionine-valine-glycine-alanine-alanine-serine TAC CAA CCA CGC CGC UCA What …
  4. Gentics

    Using donor DNA from an E. coli strain of leu+ arg+ trp- you transform a resipient strain that is leu- arg- trp+ and select for leu+. The resulting 100 colonies are then screened for the arg and trp markers and the results are outlined …
  5. College Genetics

    Using donor DNA from an E. coli strain of leu+ arg+ trp- you transform a resipient strain that is leu- arg- trp+ and select for leu+. The resulting 100 colonies are then screened for the arg and trp markers and the results are outlined …
  6. Biology

    1) What is the minimum number of single nucleotide substitutions that would be necessary for each of the following amino acid replacements?
  7. mRNA

    sometimes a mistake occurs in the stranslation of an mRNA strand. Suppose that the reading of the mRNA stand ATGCCCGCTATCCGACGATAA began, by mistake, at the second nucleotide instead of the the first . Write the sequence ot amino acids …
  8. Science

    The following DNA sequence represents a eukaryotic gene. Indicate which is the template and which is the coding strand, determine where transcription begins (assume it ends at the end of the sequence presented), write out the nucleotide …
  9. biology help plz?????????????????

    the mRNA squence below is shown along with the polypeptide which would be produced when it is translated .what polypeptide would be produced if the fifth base in the mRNA sequence shown had been changed to A as result of a mutation …
  10. Biology

    Does it matter which strand is the 'code strand'?

More Similar Questions