Post a New Question

Biology (multiple choice!)

posted by .

In a symbiotic relationship between organisms of significantly different sizes, the larger
organism is called the ___________, and the smaller organism is called the
___________________.

  • Biology (multiple choice!) -

    If this is multiple choice, what are the choices?

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. numerical & proportional reasoning

    students in a biology class measured and recorded the lengths of different microscopic organisms. the results are recorded below. organism lenght(millimeters) a 0.00065 b 4.72* 10(exponent -4) c 8/10,000 d ?
  2. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  3. science

    in a symbiotic relationship a) both organisms always benefit b) both organisms are harmed c) both organisms never benefit d) at least one organism always benefits e) neither organisms is affected d
  4. Biology (multiple choice!)

    I'm studying for a test and can't find the answers for the following questions...please help! What clade of bacteria produce oxygen via photosynthesis?
  5. Biology

    A relationship in which a single celled organisms live within the cells of another organism is called what?
  6. Science

    1. In most organisms, what kind of organisms are producers plants 2. What benefit do decomposers provide for an ecosystem?
  7. Science

    1. In most organisms, what kind of organisms are producers Answer:plants 2. What benefit do decomposers provide for an ecosystem?
  8. Science

    How does eye location beast represent the relationship between sturcture and function?
  9. Biology (CHECK)

    Describe how comparing the anatomy of living species provides evidence of evolution. A: Comparisons of the anatomy of different types of organisms often reveal basic similarities in body structures even though the structure's functions …
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions

Post a New Question