Post a New Question

genetics/genome sequencing

posted by .

I pasted the sequences of human and chimps into Transeq and this is what I got:

>exo18_MYH16_human_1
EQLNKLMTTLHSRTPFCPLYYPQ*V*AIG

>exo18_MYH16_ximpanze_1
EQLNKLMTTLHSTAPHFVRCIIPNEFKQSX

I know that the * signifies gaps. I need help with this question, as I am not sure what it means/how to answer it? Thanks!


Speculate with the functionality of the orthologs in humans taking into account that the gene under study has 42 exons.

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. GBE (Genetics)

    What are the advatages of Eukaryotic genes splitting up?
  2. Science

    Plants, cows and humans use the same amino acids to make up their proteins and yet the proteins are very different. Why?
  3. 8th grade science

    For my quiz some of these questions confuse me. Your genome is over 99% identical to every other human on earth. True False 3 points Save All living things on earth share certain identical sequences of bases on their genome. True False …
  4. Genetics

    Name the term used to describe the phenomenon in which a bacteriophage genome incorporates its genome into the chromosome of the host.
  5. biology

    Below the human hemoglobin sequence are the first thirty amino acid sequences of several other species’ hemoglobins. Inspect the sequences and answer the following questions: Human) h l t p e e k s a v t a l w g k v n v d e v g g …
  6. Biology

    When making comparison of sequences where some are whole genome sequences while others are partial genome sequences, or a specific glycoprotein sequence, How is it that we are able to make comparisons from these sequences if they all …
  7. Biology

    Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC …
  8. Genetics

    which do you think was the more far-reaching accomplishment, determining the structure of dna, or sequencing the human genome?
  9. psychology

    i need 2 examples of what researchers on the human genome project have already learned a bout the human genome
  10. Genetics

    Obviously, there was no point in history in which the clade that developed into ‘humanity’ consisted of only one female individual. Yet every mitochondrial genome in any current human population can be traced back to a single woman: …

More Similar Questions

Post a New Question