biology

posted by .

a hibiscus plant was attacked by mealybugs which completely destroyed them.the mealybug was said to have thrived because it was not in its natural habitat.what is the likely effect of introducing an organism,like
the mealybug,into a new habbitat?

  • biology -

    if the mealybugs keep eating and eating and eating the plants, that certain plant might completely disappear from that region

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Biology

    Please explain briefly about the difference between the words 'community' and 'habitat'. The textbook said "The place where an organism occurs is called its habitat" and "All the populatons of plants and animals in the same habitat …
  2. 5th grade

    a new organism is found that is multicellular, does not have a backbone, and has six legs. while studying the organism, you notice that it develops somewhat like a grasshopper. explain how you would classify this organism, and discuss …
  3. biology

    a hibiscus plant was attacked by mealybugs which completely destroyed them.what is the relationship between the mealybug and the hibiscus plant.
  4. 5th grade

    A new organism if found that is multicellular, does not have a backbone, and has six legs. It looks like a grasshopper. Classify this organism in two ways.
  5. Biology

    There are 10 Characteristics of a living organism 1. Composed of one or more cells 2. evolve into a new type of organism 3. carries out and controls a variety of Chemical reaction 4. produces offspring resembling itself. What are 6 …
  6. Science

    6. Owls are nocturnal hunters and depend on their acute vision for survival. If an owl with cataracts is determined to be inherited and she is released back into her natural habitat, she could pass the allele for cataracts on to her …
  7. History

    8.)How did henry David Thoreau inspire later A.)By introducing civil disobedience*** B.)By introducing a new genre of writing C.)By convincing the people to believe in God D.)By introducing the benefits of solitary living A?
  8. History

    9.)How did Henry David Thoreau inspire later American reformers?
  9. Maths ( permutation and combination)

    a town council plans to plant 12 trees along the centre of a main road.It has 4 hibiscus trees, 6 Jacaranda trees, 2 oleander trees. How many different arrangements of these 12 trees can be made if no hibiscus tree is next to another
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions