biology

posted by .

1. name an organism in which the respiratory and circulatory systems are separate.

2. name an organism with a closed circulatory system that is not used for gas exchange.

3. name an organism whose waste gases accumulate in one system but then move to another system for removal.

4. name a group of organisms in which some used a swim bladder for gas exchange outside of water.

5. name an organism that changes from gill breathing to lung breathing as it matures.

  • biology -

    5. tadpole - frog

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Biology

    What are the levels of organization in a living system?
  2. science

    If waste products of an aquatic single celled organism were released by the organism into the pond, how would that affect the organism’s ability to obtain oxygen from the pond water?
  3. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  4. Biology

    Match the terms with the correct description: a. regulates supply of gases from ATP production b. provides negative feedback signals c. protects body against foreign dangers d. "rapid transit" for liquids and gases e. primary "regulator" …
  5. Biology

    *Yawn* Match the terms with the correct description: a. regulates supply of gases from ATP production b. provides negative feedback signals c. protects body against foreign dangers d. "rapid transit" for liquids and gases e. primary …
  6. Biology

    Match the terms with the correct description: a. regulates supply of gases from ATP production b. provides negative feedback signals c. protects body against foreign dangers d. "rapid transit" for liquids and gases e. primary "regulator" …
  7. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  8. Science

    Structure, Function, Information Processing Test: Unit2 1. Enzymes are important because they: contain water speed up chemical reactions***** contain genetic material help the cell maintain its shape. 2. Which term refers to the diffusion …
  9. Bio

    What is an advantage of using an organism's scientific name rather then its common name?
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions