Biology

posted by .

Describe the interactions between organism and explain why they are important.

Thank you!

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. numerical & proportional reasoning

    students in a biology class measured and recorded the lengths of different microscopic organisms. the results are recorded below. organism lenght(millimeters) a 0.00065 b 4.72* 10(exponent -4) c 8/10,000 d ?
  2. Biology (multiple choice!)

    In a symbiotic relationship between organisms of significantly different sizes, the larger organism is called the ___________, and the smaller organism is called the ___________________.
  3. biology

    List,explain and provide an example of 3 natural interactions that exist between species.
  4. business

    Appendix B Answer each question below. Answers should be approximately 100 words per question. 1. What are the primary roles of media delivering news to the public?
  5. biology

    1.explain how the code that is found in the organism`s genes works 2.describe how the genetic code controls the production of proteins 3.find diagrams to help explain thankyou!
  6. biology

    What are coupled reactions? Describe the interactions between enzyme, substrate, active site and the induced fit model Explain how changes in temperature, and pH affect the function of enzymes Recognize the structure of ATP, and be
  7. Biochemistry

    1. Describe the ran world hypothesis 2. A) list the types of non covalent interactions that are important in providing stability to the three dimensional structures of macromolecules. (B) why is it important that these interactions …
  8. Biology (CHECK)

    Describe how comparing the anatomy of living species provides evidence of evolution. A: Comparisons of the anatomy of different types of organisms often reveal basic similarities in body structures even though the structure's functions …
  9. science help pls pls

    Derek designed an experiment to demonstrate interactions between Earth systems. He cleared a patch of land in his backyard and poured a glass of water from a height of 12 inches above the ground. A depression was formed on the land …
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions