10th grade

posted by .

A specific structure in a single-celled organism.How the structure is involved in the survival of the organism?

  • 10th grade -

    What structure?

  • 10th grade -

    Cell walls

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. science

    are the cells of a many celled organism more or less effiecient than a one-celled organism and why
  2. 10th grade biology

    you find an unusual organism growing on the bark of a dying tree . Under a microscope , you observe the cells are eukaryotic , have cell walls , and do not contain chloroplasts . Into what kingdom . Would you place this organism ?
  3. science

    If waste products of an aquatic single celled organism were released by the organism into the pond, how would that affect the organism’s ability to obtain oxygen from the pond water?
  4. science

    If waste products of an aquatic single celled organism were released by the organism into the pond, how would that affect the organism’s ability to obtain oxygen from the pond water?
  5. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  6. biology

    in which domain should a biologist classify a single-celled organism containing a nucleus
  7. Biology

    A relationship in which a single celled organisms live within the cells of another organism is called what?
  8. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  9. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …
  10. Biology help needed bad!

    A biologist discovers a new unicellular organism and classifies it as a prokaryote. The cell is very small, contains a cell membrane, a cytoplasm, DNA in a nucleus, and no other cell organelles. Which statement below represents a correct …

More Similar Questions