bio

posted by .

Scientists often want to know if the genetically transformed organism can pass its new
traits on to its offspring and future generations. To get this information, which would be
a better candidate for your investigation, an organism in which each new generation
develops and reproduces quickly, or one which does this more slowly?

  • bio -

    How long do you want to wait to find your results?

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. biology

    Are an organism's characteristics determined only by its genes?
  2. 5th grade

    a new organism is found that is multicellular, does not have a backbone, and has six legs. while studying the organism, you notice that it develops somewhat like a grasshopper. explain how you would classify this organism, and discuss …
  3. science- bio

    how can traits on a particular chromosome be determined?
  4. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  5. Biology

    There are 10 Characteristics of a living organism 1. Composed of one or more cells 2. evolve into a new type of organism 3. carries out and controls a variety of Chemical reaction 4. produces offspring resembling itself. What are 6 …
  6. 11Science

    A diploid organism has five pairs of chromosomes in each somatic cell. Assuming that no crossing over occurs, how many genetically distinct gametes can this organism produce?
  7. Science

    Which of the following occurs during artificial selection, but not during natural selection?
  8. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  9. Science

    1. How might sexual reproduction decrease an organism’s chance of survival?
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions