Bio 157

posted by .

I need to describe prokaryotic and eukaryotic chromosomes.

I think I got prokaryotic

the circular DNA molecule of prokaryotic organisms, containing the majority of the genes for the cell.

I can't seem to define eukaryotic can u help?

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. Biology

    Describe two similarities and two differences between eukaryotic cells and prokaryotic cells. Why do you think eukaryotic cells developed?
  2. biology

    1. From one molecule of glucose, which process generates the largest amount of ATP?
  3. Biology

    b) Identify one similar and one different way each type of cell [prokaryote and eukaryote] uses flagella. My answer: In both prokaryotes and eukaryotes, flagella protrude from the cell's surface and enable movement. Prokaryotic flagella …
  4. Biology

    a) What is a major structural advantage that eukaryotic cells have over prokaryotic cells?
  5. Biology

    Using Darwin’s Theory of Evolution, describe how Eukaryotic cells could have developed from Prokaryotic cells. What advantages would the Eukaryotic cells have over the Prokaryotic?
  6. biology

    Which of the follow comparisons would be an inaccurate analogy between prokaryotic cells and eukaryotic cells?
  7. science

    Which of the follow comparisons would be an inaccurate analogy between prokaryotic cells and eukaryotic cells?
  8. Biology*STUCK*

    A group of students was asked to list some of the similarities and differences between prokaryotic cells and eukaryotic cells. They created the table shown above. The students made a mistake in creating their table. Which statement …
  9. Biology

    Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC …
  10. Biology

    List 3 differences between eukaryotic and prokaryotic genomes. Describe how one of these differences might impact laboratory applications. What are two issues that might arise when genetically engineering a prokaryotic cell to express …

More Similar Questions