5th grade

posted by .

a new organism is found that is multicellular, does not have a backbone, and has six legs. while studying the organism, you notice that it develops somewhat like a grasshopper. explain how you would classify this organism, and discuss the stages of its development

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. numerical & proportional reasoning

    students in a biology class measured and recorded the lengths of different microscopic organisms. the results are recorded below. organism lenght(millimeters) a 0.00065 b 4.72* 10(exponent -4) c 8/10,000 d ?
  2. bio

    Scientists often want to know if the genetically transformed organism can pass its new traits on to its offspring and future generations. To get this information, which would be a better candidate for your investigation, an organism …
  3. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  4. 5th grade

    A new organism if found that is multicellular, does not have a backbone, and has six legs. It looks like a grasshopper. Classify this organism in two ways.
  5. Science

    A new organism is found that is multicellular, does not have a backbone and has six legs. Classfy this organism in two ways.
  6. Science

    A new organism is found that is multicellular, does not have a backbone, and has six legs. How would you classify this organism?
  7. Biology

    You find an unusual organism growing on the bark of a dying tree. Under a microscope, you observe that its cells are eukaryotic, have cell walls, and do not contain chloroplasts. Into what kingdom would you classify this organism?
  8. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  9. Science

    1.) when might preserved remains of an entire organism form?
  10. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …

More Similar Questions