Math

posted by .

A microscopic organism is shown in a biology book with the length of 5.6 centimeters. If the scale of the picture is 2000:1, find the actual length of the organism.

  • Math -

    Divide 5.6 cm by 2000 for the answer.

Respond to this Question

First Name
School Subject
Your Answer

Similar Questions

  1. numerical & proportional reasoning

    students in a biology class measured and recorded the lengths of different microscopic organisms. the results are recorded below. organism lenght(millimeters) a 0.00065 b 4.72* 10(exponent -4) c 8/10,000 d ?
  2. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26 chromosomes …
  3. Math

    On a map the length of a nature- center trail is 4.6 centimeters. If the scale is 2 centimeters to 30 kilometers. What is the actual length of the trail.
  4. math

    On a map, the length of a nature-center trail is 10.8 centimeters. If the scale is 3 centimeters to 20 kilometers, what is the actual length of the trail.
  5. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism?
  6. Science

    How does eye location beast represent the relationship between sturcture and function?
  7. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism …
  8. math

    A boy draw the frame of a picture to a scale of 1cm to 15cm.if his drawing has 5cm length and 3cm as breath, what is the actual length and breath of the picture?
  9. math

    A boy draw the frame of a picture to a scale of 1cm to 15cm.if his drawing has 5cm length and 3cm as breath, what is the actual length and breath of the picture?
  10. Math

    A one-celled organism measures 32 millimeters in length in a photograph. If the photo is enlarged by a factor of 100, what is the actual length of the organism?

More Similar Questions