Questions LLC
Login
or
Sign Up
Ask a New Question
Biology
Genetics
DNA Transcription
if a start codon changes into a stop codon, how would this effect transcription? please help.
1 answer
the transcription would stop.
You can
ask a new question
or
answer this question
.
Related Questions
Question 3
A) The amino acid serine is coded by the mRNA codon AGU. What is the base sequence of the DNA gene that originally
Finally - using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA
The amino acid serine is coded by the mRNA codon AGU. What is the base sequence of the DNA gene that originally produced this
Below is a codon - amino acid chart. You read the chart from the inside out. Review this video for a reminder of how to read a
The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???):
!!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAAC
Would someone help me with the following...it's not A.Thnx!!
What would happen if the mRNA codon that coded for Cys was mutated
A DNA codon that codes for a certain protein undergoes a substitution mutation. The new codon codes for the same amino acid as
Which statement correctly describes the structure of a codon? (1 point)
A codon is a sequence of chromosomes. A codon is a
If there's 4 nucleotides, what is the probability to get a start codon ?
If I understand correctly; a codon = 3 nucleotides, so
A silent point mutation is caused by which of the following?
• a gene moves to a different chromosome • mutated codon is a