Questions Asked on
October 28, 2016

  1. Language Arts

    Hi. I need to check my answers and I would hate to get them wrong because of one little mistake. Thanks! 1. An argumentative essay should present a clear thesis statement, provide strong evidence to support the thesis, and _____. a. Address

    asked by Dani
  2. math

    It takes 18 electricians 35 days to wire a new housing subdivision. How many days would 28 electricians require to do the same job?

    asked by allie
  3. english

    14. which quotation from nethergrave best conveys jeremys desire to escape the real world. a. "oh, i guess you mean those stories i make up online. You know about them?"*** b. "I played in a soccer tournament at school , and i kicked the winning goal." c.

    asked by New qustions
  4. Social Studies

    What was the unanswered question of the Nullification Crisis A). does the federal government have absolute power to place traffic as goods? B). does the state have the right to mullfiy other states laws? C). Does the fedrl government or do the states have

    asked by Izzie
  5. Math

    You must scuba dive to the entrance of your room at Jules’ Undersea Lodge in Key Largo, Florida. The diver is 1 foot deeper than 2/3 of the elevation of the entrance. What is the elevation of the entrance?

    asked by vivis
  6. Language Arts

    The narrator of stolen day says his family often laughs at him.How does he react when they do? A.He wishes he were an orphan. B.He dislikes everyone he knows. C.He appreciates the attention. D.He dislikes being teased. My answer is D. can you please check

    asked by I NEED HELP PLEASE!!!
  7. Chem

    Calculate the value of work, w, for the following system if 26.7 g of NaN3 reacts completely at 1.00 atm and 22 °C.

    asked by Morgan
  8. (Math) PLZ CHECK ANSWERS

    1. Which number is a solution of the inequality? 10.68 A)-5 B)-6 C)6 D)7*** 3. Which number is a solution of the inequality? 6>z(10-z) A)0 B)1 C)2 D)3*** 4. What are all the subsets of the set? {-1,9} A) 0, {-1}, {9}*** B) {-1}, {9}, {-1, 9} C) 0, {-1},

    asked by Katrina
  9. Biology

    Has anyone done the effect of cell size on material transport portfolio in Connections academy?

    asked by Amanda
  10. Calculus

    How to derive cosh (3x) in terms of cosh (x) and sinh (x) ? Initially I start with 1/2 (e^3x+e^-3x) but I'm stuck from there because I don't know how to continue... :(

    asked by Matilda
  11. The Pignman and Me answers!! PLZ HELP OVER DUES!

    Which of the following passages from the pigman and me help to create a humorous mood? A. I just shut up and stared down at the ground b. I was terrified because I didn't know how to fight c. May you left ear wither fall into your right pocket! d. He

    asked by naenaecutegirl
  12. Social Studies

    Which of the following is a characteristic of Earth's first people? A. They lived in cold places B. They lives far from water sources C. They lived on the Asian continent D. They moved around in search of food** How do people in northern Chad adapt to the

    asked by Anonymous
  13. math

    rearrange A = 2 pi r (r+h) to make h the subject (cylinder)

    asked by melanie
  14. chemistry

    Consider these reactions where M represents a generic metal 1. 2M(s) +6HCl(aq) --> 2MCl3(aq)+3H2(g) (deltaH)= -725.0 kj 2. HCl(g)-->HCl(aq) (deltaH)= -74.8kj 3. H2(g)+CL2(g) --> 2HCl(g) (deltaH)=-1845.0kj 4. MCL3(s) --> MCl3(aq) (deltaH)= -476.0kj Use the

    asked by anon
  15. history

    1. Which of the following crimes would result in a slave’s execution? (Choose all that apply.) (2 points) murder failing to work diligently plotting a rebellion stealing food 2. Which of the following was true about the life of a slave? (1 point) They

    asked by You yo daddy's son
  16. Algebra

    Working together, two people can cut out a large lawn in 2 hr. One person can do the job alone in 1 hr less than the other? How long (to the nearest tenth) would it take the faster worker to do the job? (Let x representthe time of the faster worker).

    asked by Darleene Gomez
  17. physics

    Children slide down a frictionless water slide that ends at a height of 1.80 m above the pool. If a child starts from rest at point A and lands in the water at point B, a horizontal distance L = 2.46 m from the base of the slide, determine the height h of

    asked by Amy
  18. Social Studies

    What natural resource attracted other nations to trade with West and Central Africa beginning around AD 750? A. copper B. silver C. gold** D. salt Which of the following is an example of how people have adapted to the environment of West and Central

    asked by Anonymous
  19. chemistry

    Given these reactions : X(s) + 1/2O2(g) --> XO(s) (Delta)H= -707.7 kj XCO3(s) --> XO(s)+CO2(g) (Delta)H= +381.9kj What is (delta)Hrxm for this reaction? X(s)+1/2 O2(g)+CO2(g) ---> XCO3(s) (Delta)H= ?

    asked by anon
  20. Algebra

    Tell whether the sequence is arithmetic. if it is what is the common difference? A. no B. 1/4 C. 1/8 D. 8 My best answer is A. is that correct

    asked by Leslie
  21. easy math

    What value of c makes x^2 + 6x + c a perfect square trinomial? 3 6 9 12

    asked by Don
  22. Social Studies

    Which of the following is a serious economic problem in North Africa? A. lack of oil resources B. a decline in tourism C. unemployment** D. poor agricultural performance What language unifies much of North Africa? A. English B. French C. Moroccan D.

    asked by Anonymous
  23. Statisics

    A state university annual report showed that its retention rate was at 24% and university officials would like to increase this rate. After implementing several new programs during the last two years, the university reevaluated its retention rate. What is

    asked by Tameka
  24. Spanish

    what is a common tradition for families in the Spanish speaking world that is not necessarily a tradition in America? A)men and women often live at home until married** B)young people talk to elders using the informal "Tu" C)Children spend little time with

    asked by Cyborg_DRAGon
  25. Physics

    Three children are riding on the edge of a merry–go–round that is 84 kg, has a 1.40–m radius, and is spinning at 20.0 rpm. The children have masses of 21.0, 24.0, and 29.0 kg. If the child who has a mass of 24.0 kg moves to the center of the

    asked by Cristina
  26. Health and Physical Education

    BMI is a ratio to? •Height to body fat •Weight to height •Muscle mass to bone mass •weight to activity level

    asked by Shayla
  27. physics

    A child with a mass of 46 kg is riding on a merry-go-round. If the child has a speed of 3 m/s and is located 2.2 m from the center of the merry-go-round, what is the child's angular momentum? ____kg2/s

    asked by Sue
  28. math

    Tom used 5/8 yard of ribbon to tie weights on the tail of his kite. He cut the length of ribbon in equal pieces that were 1/12 yard long. How many pieces, each 1/12 yard long did Tom cut from the 5/8 yard ribbon?

    asked by Thomas
  29. Social Studies

    What natural resource attracted other nations to trade with West and Central Africa beginning around AD 750? A. copper B. silver C. gold** D. salt Which of the following is an example of how people have adapted to the environment of West and Central

    asked by Anonymous
  30. english

    None of the students ________ happy with the instructor because she ________ homework every weekend.

    asked by Anonymous
  31. chemistry

    Calculate the standard enthalpy change for the following reaction at 25 °C. H2O+C(graphite)(s) --> H2(g) +CO(g)

    asked by anon
  32. Math

    Write the ratio in simplest form. 50:10 A.25:5 B.10:2 C. 5:1 D.1:5 Is the answer C?

    asked by Noah
  33. math

    If two dice are rolled and their faces noted, find each of the following probabilities: a) the sum of the two dice is 8 b) both dice show even numbers c) the sum of the two dice is 8 OR both dice show even numbers d) the sum of the numbers is 7, given that

    asked by Anonymous
  34. PHYSICS

    A ball of mass 0.15kg is dropped from a height of 1.0m onto a flat surface and rebounds to a height of 0.35m. Calculate: (a) The speed of the ball just before the impact, (b) The speed of the ball just after impact, (c) The change of momentum, (d) The

    asked by urgent help needed
  35. chemistry

    A 2.50-g sample of powdered zinc is added to 100.0 mL of a 2.00-M aqueous solution of hydrobromic acid in a calorimeter. The total heat capacity of the calorimeter and solution is 448 J/K. The observed increase in temperature is 21.1 K at a constant

    asked by anon
  36. Math

    An employee's annual salary was increased from $22,464.00 to $24,710.40 last year.If it is increased by the same percent this year,what will be the employee's salary? Thanks!

    asked by Sandy
  37. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism 5:

    asked by Maria
  38. BUSINESS MANAGEMENT

    examine the impact of one's family background and setting to work place behaviour?

    asked by George
  39. Physics

    A wire with cross sectional area 1.00 cm2 stretches 0.500% of its length when it is stretched with a tension of 20.0 N. What is the Young's modulus of this wire?

    asked by Rick
  40. Chemistry

    A mixture of NaOH and HCl is formed in a calorimeter. There is 50 mL of 2.078 Molar HCl and 51.7mL of 2.134 Molar NaOH. How would the heat capacity of the calorimeter change if you were to double the volume of NaOH? Justify your answer

    asked by Max
  41. math

    Your brother is saving labels from soup cans. He removes the labels from three cans of pea soup, five cans of vegetable soup and four cans of onion soup, and does not indicate the contents of the twelve cans after removing the labels. You need two cans of

    asked by Anonymous
  42. Business Calculus

    As the financial consultant to a classic auto dealership, you estimate that the total value (in dollars) of its collection of 1959 Chevrolets and Fords is given by the formula v = 306,000 + 1,000t2 (t ≥ 5) where t is the number of years from now. You

    asked by Anonymous
  43. PHY 2

    How many electrons per second pass through a section of wire carrying a current of 0.70A?

    asked by Marl
  44. chemistry

    A researcher studying the nutritional value of a new candy places a 4.10-gram sample of the candy inside a bomb calorimeter and combusts it in excess oxygen. The observed temperature increase is 2.47 °C. If the heat capacity of the calorimeter is 33.90

    asked by anon
  45. chemistry

    How many grams of potassium iodide, KI, are required to make 2.0 L of a 0.1M solution?

    asked by Blake
  46. principle of management

    examine the impact of one's family background and setting to work place behaviour?

    asked by George
  47. chemistry

    The following equation is the balanced combustion reaction for C6H6: 2C6H6(L) + 15O2(g) --> 12CO2(g)+6H2O(L)+6543 kj If 7.700 g of C6H6 is burned and the heat produced from the burning is added to 5691 g of water at 21 °C, what is the final temperature of

    asked by anon
  48. physics

    A variable-speed drill, initially turning at 150 rpm, speeds up to 1300 rpm in a time interval of 1.0 s. What is its average rotational acceleration? ______rpm/s2

    asked by Sue
  49. math

    Suppose 2% of the items made in a factory are defected. Find the probability that no defective in a sample of 50.

    asked by shubham
  50. Physics

    A square metal plate with length L= 0.14 m on each side is pivoted about an axis through the center point O, perpendicular to the plate. Calculate the net torque about this axis due to the three forces shown that act at the corners, with magnitudes F1 =18

    asked by Anonymous
  51. electric heating appliance and fan

    bus bars are used in an electric iron as

    asked by chris
  52. chemistry

    Liquid sodium is being considered as an engine coolant. How many grams of liquid sodium (minimum) are needed to absorb 7.00 MJ of energy (in the form of heat) if the temperature of the sodium is not to increase by more than 10.0 °C? Use CP= 30.8

    asked by anon
  53. chemistry

    An 80.0-gram sample of a gas was heated from 25 °C to 225 °C. During this process, 346 J of work was done by the system and its internal energy increased by 8305 J. What is the specific heat of the gas?

    asked by anon
  54. Science

    Calculate the pH of a solution containing 2g of caustic soda per litre of water

    asked by Deepali
  55. Math

    In a survey of 380 households regarding the ownership of VCRs and DVD players, the following data was obtained: ​ 350 households own one or more VCRs. ​180 households own one or more VCRs and one or more DVD players. ​13 households do not own a VCR

    asked by Kal Jay
  56. math

    Six slips of paper, with a different digit from 1 to 6 printed on each, are placed in a box. The papers are well mixed. One slip is drawn and replaced. The papers are well mixed, and a second slip is drawn. Find the probability of each of the following: a)

    asked by Anonymous
  57. chemistry

    When a 8.00-g sample of KBr is dissolved in water in a calorimeter that has a total heat capacity of 3.344 kJ·K–1, the temperature decreases by 0.400 K. Calculate the molar heat of solution of KBr.

    asked by anon
  58. Chemistry

    Please write down the redox reactions (using the half-reaction method!) a)Cl2 from OCl- and Cl- in acidic solution b)Br2 from BrO3- and Br- in acidic solution -You don't have to do both, but could you help me step up the half reactions especially for OCl-

    asked by Annie
  59. math

    A total of 600 tickets were sold for the school play. They were either adult tickets or student tickets. There were 50 fewer student tickets sold than adult tickets. How many adult tickets were sold?

    asked by gena
  60. chemistry

    When 1367 J of heat energy is added to 44.1 g of hexane, C6H14, the temperature increases by 13.7 °C. Calculate the molar heat capacity of C6H14.

    asked by anon
  61. math

    A manufacturer of calculators would like to separate defective calculators from calculators that are acceptable. Through an error, a shipment of 12 calculators is sent out containing 3 defective calculators and 9 working calculators. A customer buys 5 of

    asked by Jenna
  62. English

    What is the thesis statement in this essay? Instead of using emails, mail a letter to your grandparents, an aunt or uncle, or another role model who’s older than you are. We live in a fast-paced world. We use computers to send emails and instant

    asked by anonymous
  63. college chemistry

    using cu+2AgNo3= Cu(No3)2 + 2Ag if you start with 100 grams of copper how many grams of silver can be obtained

    asked by jordan
  64. chemistry

    At constant volume, the heat of combustion of a particular compound is –3947.0 kJ/mol. When 1.311 g of this compound (molar mass = 136.58 g/mol) was burned in a bomb calorimeter, the temperature of the calorimeter (including its contents) rose by 4.343

    asked by anon
  65. math

    (Evaluate) -5g - 6 for g=-2 A)4 B)16 C)10 D)-13

    asked by Cyborg_DRAGon
  66. Math (Derivative)

    Compute derivative using the definition of the derivative. f(x)=1+1/x^2 1+ 1/(x+h)^2 - (1+ 1/(x^2)) ------ divide by h and multiply by reciprocal 1/h(x+h)^2 - 1/hx^2 Next I expanded it and got this messy huge number and multiply the bottom of each other

    asked by Ray
  67. Math

    I really need help like, in 5 minutes please!! its this: 23/40 minus 11/30

    asked by Princess Flower
  68. Calculus I

    (Six pigpen problem). A 2 × 3 array of six congruent rectangular pigpens (that all look the same from above) will be in the overall shape of a rectangle R. We may use 100 feet of fencing to form the boundaries of the pigpens. Find the dimensions for a

    asked by Rebecca
  69. Chemistry

    What is the molarity of each ion present if 18.0 g of Al2(SO4)3 is present in 201 mL of solution? _____ M Al3+ _____M SO42-

    asked by Anonymous
  70. Physics

    A rigid rod of mass 0.2 kg and length 1.5 m is suspended by wires at each end. The wireshave equal rest length. The wire on the left end of the rod has Young’s modulus4*10^11Pa, while the one on the right end has Young’s modulus2*10^11Pa. A 2 kg mass

    asked by Anonymous
  71. Math

    What is 23/40 minus 22/30? use benchmark

    asked by Princess Flower
  72. Math

    1/6 is the sum of two unit fractions. how may pairs of unit fractions will equal 1/6?

    asked by Jason
  73. English

    In First Confessions, Nora can best be identified as? A:flat*** B:round C:dynamic D:protagonist

    asked by Anonymous
  74. algebra

    terry earns $6.50 per hour babysitting. a. write a rule to describe how the amount of money m earned is a function of the number of hours h spent babysitting. b. how much money does terry earn if she babysits for 4 hours and 15 minutes? A. m(h)= 4h+

    asked by Leslie
  75. chemistry

    If you combine 360.0 mL of water at 25.00 °C and 120.0 mL of water at 95.00 °C, what is the final temperature of the mixture? Use 1.00 g/mL as the density of water.

    asked by anon
  76. Algebra

    terry earns $6.50 per hour babysitting. a. write a rule to describe how the amount of money m earned is a function of the number of hours h spent babysitting. b. how much money does terry earn if she babysits for 4 hours and 15 minutes? A. m(h)= 4h+

    asked by Leslie
  77. Photography

    IS this statement true or false? 100 ISO for film = 800 ISO for digital. I'm not sure. I only learnt ISO for digital. I don't know how to check if they are both equal.

    asked by Amy
  78. math

    how many squares are there in a 3x3 geoboard? how many rectangles?

    asked by jose
  79. Math

    A glass containing 250 mL of 80% iodine solution tips over spelling part of its contents. This subsequently replaced by an amount from a mixture of 40% iodine. If a 72% solution is resulted, how much was spilled?

    asked by Math
  80. Physics

    A ball roll down a hill with a constant acceleration of 20m/s if the ball start from rest. What is it velocity at the end of 4.05

    asked by Elisha
  81. PHYSICS

    A uniform ladder of length 20.0m and weight 750 N is propped up against a smooth vertical wall with its lower end on a rough horizontal surface. The coefficient of friction between the ladder and this horizontal surface is 0.40. (a) Draw a diagram for the

    asked by urgent help needed
  82. time speed and distance

    P, Q and R start from the same place X at (a) kmph, (a+b) kmph and (a+2b) kmph respectively.     If Q starts p hours after P, how many hours after Q should R start, so that both Q and R overtake P at the same time?    Answer is pa/a+2b    Your

    asked by vipul
  83. math

    Hospitals contain backup generators in case of power failure. A hospital has two backup generators each of which has a 2% probability of failure. Only one generator is needed to supply emergency power. What is the probability that the backup system will

    asked by Anonymous
  84. Biomechanics

    An athlete jumps straight upwards at 2.5 m/s, find: 1. a) total flight time 2. b) maximum jump height

    asked by Matt
  85. Algebra

    A company has a fixed monthly manufacturing cost of $12,000 and it costs $0.95 to produce a mechanical pencil. They then sell each pencil for $1.25. How many units must be sold before this company breaks even?

    asked by Anne
  86. Math (Finding Vertical Tangent)

    List all x values where the graph of f(x) has vertical tangents goo.gl/photos/iPu1SHA8yyBFTcZj6

    asked by Ray
  87. chemistry

    If the heat of combustion for a specific compound is -1180.0 kJ/mol and its molar mass is 40.91 g/mol, how many grams of this compound must you burn to release 114.50 kJ of heat?

    asked by anon
  88. Math

    How is an inequality different from an equation? Give a real-world scenario in which you would write an inequality rather than an equation. Sky has $25. She wants to buy two new Coats for her and a friend. Sky needs to know the average price so she doesn't

    asked by Embershy
  89. math

    You are hired by your local member of parliament to conduct a survey on unemployment, crime, taxes and mail delivery. You make up a question on each topic for your survey sheet. If the questions are arranged in random order on the sheet, find the

    asked by Anonymous
  90. Math

    I have a dash of sugar and I need to add flour with a 1:10 weight ratio of sugar to flour so how much flour do I need

    asked by Rachel
  91. Chemistry

    In the reaction of formation of sodium chloride (NaCl), 15 g of sodium is placed in contact with 20 g of chlorine. What is the reactant in excess and its mass in excess?

    asked by MONICA
  92. Chemistry

    What is the molarity of each ion present if 18.0 g of Al2(SO4)3 is present in 201 mL of solution? _____ M Al3+ _____M SO42-

    asked by Anonymous
  93. Math (Confused)

    How many international direct-dialing numbers are possible if each number consists of a four-digit area code (the first digit of which must be nonzero) and a five-digit telephone numbers (the first digit must be nonzero)? a. 567,000,000 b. 486,000,000 c.

    asked by Kal Jay
  94. Chemistry

    A good vacuum pump on Earth can produce a vacuum with a pressure as low as 1.96 × 10-8 torr. How many molecules are present in each milliliter at a temperature of 23.0ºC?

    asked by Hunter
  95. Chemistry

    A solution of concentrated NaOH is 16.7M. If the density of the solution is 1.02 g/mL, what is the percent by mass of NaOH? I have tried different calculations and molarity and % but im not catching on at all

    asked by Anonymous
  96. maths

    A landscape designer recommends that a fence be put around a circular flower bed that is 220 ft. How many feet of fence is needed if the fence is placed 3 ft from the edge?

    asked by candy
  97. Math

    450 children take part in an art competition if there are 25% more boys than girls how many more boys than girls are there

    asked by Ally
  98. Government

    Labor group: Student labor union (I am in the labor group!) Employer group: Administration of school _____________________________________ Directions: negotiate the student/admin contract (Some of these points from a realistic standpoint I wouldn't agree

    asked by Dina
  99. PHYSICS(MCAT)

    an area several km from an electricity generating station requires 120kw power on average the total resistance is line is 0.4 ohm calculate power loss if the transmission is made ata low voltage 240V

    asked by shehzad
  100. Chemistry

    A solution of NaOH(aq) contains 5.4 g of NaOH(s) per 100.0 mL of solution. Calculate the pH and the pOH of the solution at 25 °C.

    asked by Anonymous
  101. English

    1. He did not like some of them. 2. He disliked some of them. (Are both the same? Can we use 'some' as in #1?) 3. He couldn't find some of the books. 4. He couldn't find any of the books. 5. He could find none of the books. (Are they all grammatical? In

    asked by rfvv
  102. MATHS URGENT

    By making the substitution u=7^x and using part a, derive a hidden quadratic equation 7^(2x-1) +4×7^(x-1) -1/14 =0 and hence find all of the solutions to the above equation.

    asked by Please help me!
  103. math

    There are 5 black mice and 5 white mice available for an experiment. A random selection is made from the set of ten mice. What is the probability that two black mice and one white mouse will be selected? Thanks

    asked by Anonymous
  104. math

    A manufacturer of calculators would like to separate defective calculators from calculators that are acceptable. Through an error, a shipment of twelve calculators is sent out containing three defective calculators and nine working calculators. A customer

    asked by Anonymous
  105. Math

    12%+17%+3%=0.144612 The correct answer is 32% Please break it down to me where I can understand it. Thanks

    asked by Sandy
  106. Algebra

    A team won 6 out 8 games played this season? What percent of games did they win? 6 divided by 8= 0.75, but 75% is the wrong answer. What is the correct answer?

    asked by Elizabeth
  107. Calculus

    Find d^2y/dx^2 in terms of x and y given that 8x + 6y^2 = 8. Use the original equation to simplify your answer. A. y'' = -(4/9y^3) B. y'' = -9y^3 C. y'' = -4y^3 D. y'' = -27y^3 E. y'' = -(8/27y^3)

    asked by Anonymous
  108. Math Derivative

    Find derivative of f(x)=g(h(x)) Would the derivative be something like: g'(h(x))*h'(x) ??

    asked by Ray
  109. C

    A solution contains 19.0 g of NH4Cl in water and is 9.10% NH4Cl. What is the mass of water present?

    asked by Anonymous
  110. Calculus

    Given the vectors u = and v = , find 3u + 2v.

    asked by Iris
  111. math

    2[34+]4x98

    asked by vannessa
  112. Graph Theory

    Let S be a sequence of exactly one positive integers, n. what is the least number of 1s needed to be added to make it graphical?

    asked by Bruce
  113. Math

    How many kg of pure salt must be added to 8 kg of a 30% solution to obtain a 35% soltution?

    asked by Math
  114. time speed and distance

    P, Q and R start from the same place X at (a) kmph, (a+b) kmph and (a+2b) kmph respectively.      If Q starts p hours after P, how many hours after Q should R start, so that both Q and R overtake P at the same time?     Answer is pa/a+2b    

    asked by Dharmesh
  115. macomb

    Express using positive exponents and simplify, if possible. −8−1 + 8−2

    asked by serad
  116. Math

    An octopus can swim v km/h in still water. When the octopus swims against a current of 5km/h, its speed is decreased by 5km/h. When it swims with a current of 5km/h, its speed it increased by 5km/h. It takes Joey the Octopus the same amount of time to swim

    asked by jesse
  117. PreCal

    find the discriminant of (2 + sqrt3)x^2 - (4 - sqrt3)x = 1 How do I solve something like this when it has radicands?

    asked by bubble dragon
  118. math

    Destiny buys 4 notebooks for $5.20. What is the cost per notebook?

    asked by arlette
  119. math

    3C minus 243

    asked by suzy
  120. art

    i tried researching but no website gave a clear answer. Does anyone know why cubism ended or faded away in the 1914

    asked by AA
  121. MATHS URGENT

    By making the substitution u =ln x show that the following equation has exactly one real-number solution: 9/ln x + ln x^4 =-12

    asked by Please help me!
  122. Maths

    X squared-36 and 2x square -15x+18

    asked by Nitesh
  123. BASIC TECH

    With aid of pear if compass and ruler bisect a line of 12cm.

    asked by ZIONKING'S
  124. P.E.

    What is Conditioning coach and Conditioning activities..?

    asked by Jo
  125. English

    1. I don't like some books. 2. I don't like some of the books. 3. I don't eat some food. 4. I don't eat some of the food. 5. I don't buy some items. 6. I don't buy some of the items. 7. I don't know some boys. 8. I don't know some of them.

    asked by rfvv
  126. English

    If you suddenly lost everything, what would you miss most?

    asked by Jo
  127. Math

    If one be added to the numerator of a fraction it reduces to 1/5 if one be taken from the denomenator it reduces to 1/7 require the fraction

    asked by Anonymous
  128. Math

    Dan wants to cover a Shelf with shelf liner the Shelf is 4 feet wide and 2/3 feet deep what is the area of the Shelf

    asked by Tamika
  129. Math

    It take sally 2.5 hours to clean her floor. How much of the floor will have sally cleaned after only 1 hour. 1 hour = 60 min 2.5 hours =150min 60/150 =.4 so sally can clean .4 of 40% of her floor at 1 hour.

    asked by Wax
  130. math

    I am a number between 80 and 90 if you remove one from me I become a multiple of 5. If you add 2 to me I become a multiple of 8 who am I

    asked by rola
  131. organic chemistry

    inversion of S configuration to R configuration?????

    asked by Anonymous
  132. Chem

    A gas is used to fill a container up, there are 17.8 moles. What will be the new volume of the gas in the container at STP? (I don't understand which gas law to use)

    asked by Maria
  133. math

    2x^2 - 5 y = _______ 3x^2 - 4

    asked by melanie
  134. Chemistry

    A solution of concentrated NaOH is 16.7M. If the density of the solution is 1.02 g/mL, what is the percent by mass of NaOH? I have tried different calculations and molarity and % but im not catching on at all

    asked by Anonymous
  135. AP Cemistry

    Calculate the heat that must be supplied to 10.5 g of Ne(g) at 0.15 atm to raise its temperature from 24◦C to 54◦C at constant pressure. Assume that neon behaves as an ideal gas. Answer in units of J. [So, I know that we would use q = mCDT at some

    asked by David
  136. Calculus

    Given the vectors u = and v = , find -½ u. A. B. C. D.

    asked by Sade
  137. Math practice test

    Which point is located at (-3, -2)

    asked by Maytag