Questions Asked on
September 24, 2015

  1. kumasi polytechnic

    In A.P the difference between the 8th term and 4th term is 20,and the 8th term is one and half times the 4th term.Find the common difference, and the first term.

    asked by adjei
  2. Physics

    A mover has to move a heavy sofa of mass 49.0 kg to the second floor of the house. As he pulls on the rope tied to the sofa, he makes sure that the rope is parallel to the surface of the ramp, which is at 30.0° to the horizontal. If the coefficient of

    asked by Madison
  3. math

    A student takes a multiple choice quiz with 12 questions and 5 alternatives per question. Unfortunately, this student has no idea what any of the answers are, so he randomly selects an alternative for each question on the exam. Using this “blind

    asked by jordan
  4. science

    Which physical properties are characteristics of metals? Choose all that apply. -brittle -high luster -malleable -ductile -not very reactive 1, 2, and 5?

    asked by luke
  5. math

    Dan has saved $500. He wants to open a chequing account at Save-A-Lot Trust or Maple Leaf Savings. Save-A-Lot Trust's chequing account is $10 per month plus $0.75 per cheque. Maple leaf savings' chequing account is $7 per month plus $1.00 per cheque. Which

    asked by tina
  6. Math M131A

    a rubber ball has the property that on any bounce it returns to 1/3 of the height from which it just fell. Suppose the ball is dropped from 108 ft How far has the ball traveled by the fourth bounce?

    asked by sheila
  7. geometry

    Which of these is a step in constructing an inscribed square using technology?

    asked by abigail
  8. Math

    A 6-foot person standing 15 feet from a streetlight casts a 15-foot shadow. Two similar triangles are formed. One triangle is formed by the person and the shadow that the person casts. A second triangle is formed by the streetlight and the ground from the

    asked by Anonymous
  9. english

    Which of the following sentences demonstrates proper pronoun-antecedent agreement? a. Canada is proud of their hockey team. b. Both of the boys performed well in his school play. c. Neither the girl nor her friends are going to her party. d. The jar of

    asked by JR.
  10. math

    This conditional statement is true... If two angles are right angles, then they are congruent. The converse is ...If they are congruent, then the angles are right angles This would be false because not all congruent angles are right angles Is this correct

    asked by sweet pea
  11. oops geometry

    This conditional statement is true... If two angles are right angles, then they are congruent. The converse is ...If they are congruent, then the angles are right angles This would be false because not all congruent angles are right angles Is this correct

    asked by sweet pea
  12. Physics

    2) Which of the following quantities has the same dimensions as a distance? a. vt b. 1/2 at^2 c. 2at d. v^2/a v=speed, t=time a=acceleration. 3) which of the following quantities has the same dimensions as speed a. 1/2 at^2 b. at c.(2x/a)^1/2 d. (2ax)^1/2

    asked by anonymous
  13. Geometry

    The diameter of circle Z is 5 in. What is its area in terms of pi? 2.5pi squared 5pi squared 6.25pi squared 25pi squared Please help! I can't figure this out:(

    asked by SkatingDJ
  14. CICI

    How do light microscopes work? Light microscopes use an electron beam to create an image of a specimen. Light microscopes use a combination of light and lenses to magnify a specimen.*** Light microscopes use a tiny tip that traces a specimen, enlarging it.

    asked by Science
  15. Algebra

    You go to the doctor and he gives you 13 milligrams of radioactive dye. After 20 minutes, 4.5 milligrams of dye remain in your system. To leave the doctor's office, you must pass through a radiation detector without sounding the alarm. If the detector will

    asked by Marina
  16. Quick Algebra Help

    The rules for a book report say that the report should have 300 words with an absolute value deviation of at most 20 words. Write and solve an absolute value inequality that represents the acceptable number of words.Please help me!

    asked by Hannah
  17. Cincinnati state

    The perimeter of a volleyball court is 180 feet, anditswidth is 40 feet Find the length of the volleyball court

    asked by Teresa
  18. Precalculus

    A farmer with 10000 meters of fencing wants to enclose a rectangular field and divide it into two plots with a fence parallel to the sides. What is the largest area that can be enclosed?

    asked by Joselito
  19. physics

    A train at a constant 43.0 km/h moves east for 20.0 min, then in a direction 54.0° east of due north for 25.0 min, and then west for 30.0 min. What are the (a) magnitude and (b) angle (relative to east) of its average velocity during this trip?

    asked by barich
  20. Biology

    Which of these classifications is most specific? Family Genus Phylum Order I really need help on this question, and if u can do it THANK YOU SO MUCH! Its for my Biology test.

    asked by Michael
  21. math

    A scuba diver dove from the surface of the ocean to an elevation of -79 9/10 feet at a rate of -18.8 feet per minute. After spending 12.75 minutes at that elevation, the diver ascended to an elevation of -28 9/10 feet. The total time for the dive so far

    asked by kimie
  22. biology

    Which of the following is the key factor driving cellular differentiation in the body? a. chemical gradients in the cellular environment b. expression of genetic coding c. rate of transcription d. cellular nutritional status c? confused cuz transcription

    asked by SOS
  23. science

    In photosynthesis is carbon dioxide reduced to glucose while water is oxidized to oxygen? am I correct? If not, can someone explain what's reduced into what and what's oxidized into what? thanx =]

    asked by Anonymous
  24. biology

    In evolutionary terms, RNA is thought to have preceded proteins and DNA. Which of the following provides the most convincing support for this hypothesis? a. there are more types of RNA than there are of DNA b. RNA can both store genetic information and act

    asked by Tim
  25. Physics

    1) use dimensional analysis to determine which of the following expressions gives the area of a circle: is it pie r ^2, or 2 pie r? explain - pie r^2 right?? because its what they normally use to find area of a circle 2) If a distance d has units of meters

    asked by anonymous
  26. Geometry

    Points A (-10,-6) and B (6,2) are the endpoints of AB. What are the coordinates of point C on AB such that AC is 3/4 the length of AB? a. (0,-1) b. (2,0) c. (-2,-2) d. (4,1)

    asked by SkatingDJ
  27. Algebra

    A wooden artifact from an ancient tomb contains 45 percent of the carbon-14 that is present in living trees. How long ago, to the nearest year, was the artifact made

    asked by Marina
  28. Calculus

    Which of the following is not a solution to the following equation? x^3-5x^2+4 = 0 x = 0 x = 4.83 x = -0.83 x = 1

    asked by Alisha
  29. physics

    While standing on top of a 323 m tall building, you see Iron Man flying straight down toward the ground at a speed of 35.0 m/s. Just as he passes you, you drop a can of Dr Pepper off the roof. How fast is the can going when it passes Iron Man?

    asked by niro
  30. physic

    A projectile is launched from the ground at 34.8 m/s at an angle of 44.5 degrees above the horizontal. How long, in seconds, does it take such that its angle of trajectory (it's velocity vector) is 20.6 degrees below the horizontal?

    asked by elle
  31. Calculus

    Find all solutions of the equation correct to three decimal places. (ex: 0.617 or -1.764) x^3=3x-3

    asked by Alisha
  32. Learning Behaviors

    describe the temporal pattern of a typical emotional response, occording to the opponet process theory of solomon and corbit.use this theory to account for the different reactions experienced by a first time drug user and an experienced drug user providing

    asked by Sabxo
  33. FGS

    Two bulbs each of resistance 2.0ohms are connected in parallelwith a battery.calculate the current flowing through any of the bulbs if the voltage of the battery is 0.2v

    asked by Karlos
  34. algebra

    An experiment consists of spinning a spinner. The odds in favor of the spinner landing on an even number are 3:7. What is the probability that the spinner will not land on an even number? Type your answer as a decimal.

    asked by brandon
  35. Math

    A 6-foot person standing 15 feet from a streetlight casts a 15-foot shadow. Two similar triangles are formed. One triangle is formed by the person and the shadow that the person casts. A second triangle is formed by the streetlight and the ground from the

    asked by Anonymous
  36. English please help thanks

    1.Identify the complete sentence. A.Chocolate milk, chocolate fudge, ice cream, and candy. b.The average American nearly twelve pounds of chocolate each year. C.The scientific name for chocolate is Theobrina cacao. D.Loosely translated to "the food of the

    asked by countryboy15
  37. Advanced Placement Chemistry

    Hey guys! Stuck on some review problems: (My maybe answers are at the end) 1)Which of the following molecules has a nonzero dipole moment? A. CO2 B. H2 C. C12 D. CH4 E. BF3 F. None of the above has a nonzero dipole moment 2) Which of the following would

    asked by Allie
  38. biology

    what is the difference between an exergonic reaction and an endergonic reaction?

    asked by daniel
  39. Physics

    A student drops a rock from a bridge to the water 12.0 meters below. With what speed does the rock hit the water?

    asked by Sarah
  40. Science

    A skier squats low and races down a 13 ◦ ski slope. During a 7 s interval, the skier accelerates at 4.2 m/s 2 .What is the vertical component of the skier’s acceleration? Answer in units of m/s 2

    asked by Luke Smith
  41. Reading/Language Arts

    As Pedro scaled the ladder to the roof, he felt the blood in his c=veins pumping through his body. Vein can mean a blood vessel or a crack in a rock filled with mineral deposit. How is it used in this sentence? How can you tell?

    asked by BUBBY
  42. Chemistry

    How does the presence of HCl affect the charges on weak complexes?

    asked by Lou
  43. Physics

    A two-slit pattern is viewed on a screen 1.08 m from the slits. If the two fourth-order maxima are 52.8 cm apart, what is the total width of the central bright fringe?

    asked by Rachel
  44. math

    Raul had a bookshelf with 4 shelves. He had six books on each shelf. how many books does raul have?

    asked by Anonymous
  45. Algebra 1

    What value could be added to 2/15 to make the sum greater than 1/2. A. 1/15 B. 8/30 C. 5/15 D. 8/15 2. Which set of mixed numbers had a difference less than 1?

    asked by Malcolm
  46. Music

    1. How many does the whole rest occupy? A. 1 B. 2** C. 3 D. 4 3. How many beats of rest would the combination of a half note and quarter note create? A. 1 B. 2 C. 3** D. 4 4. How many sixteenth notes would it take to rest for an entire measure in 3/4 time.

    asked by Shi Buringa
  47. Physics

    Three boxes A, B, and C are placed on a frictionless surface as shown in the diagram below. If you push on box A with a force of 8.25 N, find the magnitude of the contact force between each pair of boxes. Here mA = 6.90 kg, mB = 3.80 kg, and mC = 1.50 kg.

    asked by Anonymous
  48. College Algebra

    Find the time required for an investment of 5000 dollars to grow to 7900 dollars at an interest rate of 7.5% per year, compounded quarterly

    asked by Marina
  49. Physics.

    How do I find how long it takes to drain one half of the initial volume of the conical tank . and what fraction of the full drain time is it?

    asked by Jay
  50. math

    one radio station broadcasts the weather every 8 minutes and other station broadcasts a commercial every 4 minutes. Another station plays a "Golden Oldie" every 6 minutes. If all three of the stations broadcast both a weather forecast, a commercial, and

    asked by lisa
  51. chemistry

    Use the percent composition of total protein in skim milk to determine the percent of the total protein that is due to the casein fraction.

    asked by Anonymous
  52. history

    1.What was primary cash crops of Jamestown? a. corn b. cotton c. tobacco*** d. sugar I choose c am I correct 2.What was the main reason settlers founded he new England colonies? a. land for large plantations b. religious freedom c. gold and silver**** d.

    asked by kayla
  53. biochemistry

    Based on the mass of lactose that you isolate from 1 ml of skim milk, calculate the percent composition of lactose in skim milk. (If you found protein in the “purified lactose” sample or lactose in your “purified casein” sample, then you need to

    asked by Anonymous
  54. Physics

    A 75 kg rock climber is attached to a rope that is allowing her to hang horizontally with her feet against the wall. The tension in the rope is 825 N and the rope makes a 35 degree angle with the vertical. Determine the force exerted by the wall on the

    asked by Dawson
  55. math

    Leroy invests $7,500 at 15% simple interest per year. How much interest will he earn in 10 months?

    asked by Anonymous
  56. Poetry

    What is rhyme scheme? (1 point_ The stressed and unstressed syllables within a poem a type of poetry that has no rhyme, but no rhythm (or patter of lines that rhyme within a poem) a poem that has a rhyming meter a poem consisting of ten syllables I think

    asked by Lee
  57. Algebra

    you have a rack that can fit 30 cds you can fit 7 more cds on the rack before the rack is fulll which equation models this situation appropiratly where x represents the number of cds?

    asked by Angelina
  58. calculus

    with respect to x;4^2.dx

    asked by loveth
  59. Science

    Footprints and trails are examples of trace fossils. True*** False

    asked by JustHelpMe
  60. Chemistry

    What is the concentration when each of the following is dissolved in 1.50 L of water: a) 3.00 moles of NaCl b) 10 g of KCl c) 110 mg of NaCO3

    asked by Melanie
  61. Math

    Tricia is buildng a rectangular patio. There will be 108 bricks wide and 19 bricks long. Tricia has 2000 bricks. Does she have enough bricks to build the patio? 108 x 19 = 2052

    asked by Tiera
  62. physics

    realation between earth gravity and moon gravity

    asked by kv
  63. algebra

    Compare the set {-0.7,-0.6,-7/9,-2/3} P

    asked by nana
  64. Science

    Can you Describe what happens when a roller coaster rolls downhill in terms of velocity and acceleration. Is the roller coaster increasing in velocity? Is the roller coaster accelerating?

    asked by brooke
  65. Math

    A number containing no zeros changed to 901400 after it was rounded. To what place was it rounded and why?

    asked by Stone
  66. Algebra 2

    Can someone help me simplify this please? The question is 8/√2 Here's what I've got: 8/√2 = 8/√2 * √2/√2 = 8√2/√2 Is this correct?

    asked by Jackie
  67. Physics

    A car, moving along a straight stretch of high- way, begins to accelerate at 0.014 m/s2. It takes the car 23.2 s to cover 1 km. How fast was the car going when it first began to accelerate? Answer in units of m/s.

    asked by Bob
  68. grammar

    use comma before the conjunction in a compound sentence. If two parts of a compound sentence are not joined by a conjunction,use a semicolon to separate the parts. rewrite the passage below, correcting all capitalization and punctuation mistakes. Combine

    asked by ChloeAva
  69. physic

    A ball is dropped from the top of an apartment building. A person is on a patio somewhere beneath the top of the apartment building and the person notices the ball takes 0.11 seconds to fall from the top of his patio to the bottom of his patio. The height

    asked by elle
  70. english

    story on talented boy

    asked by abc
  71. physic

    A baseball is hit from home plate and it winds up in the stands as a homerun. From the point it was hit, it lands a horizontal displacement of 121.9 meters and a vertical displacement of 21.2 meters (in +y direction). If it took 5 seconds to travel from

    asked by elle
  72. pretty please help (history)

    1. What may have caused religious disagreements amongst the colonists in colonial south Carolina? a. the capital only had an Anglican church** b. settlers weren't religious c. people did not go to church every sunday d. all of the settlers belonged the

    asked by kayla
  73. English

    1. I will have to purchase a new computer 2. I was informed that computers become outdated after a few years 3. I could not purchase replacement parts for my computer 4. My computer was not working correctly Using the sentence above, which of the following

    asked by Anonymous
  74. US History

    What were some disputes with the Foreign Affairs Troubling the Nation

    asked by Sakilya
  75. Object oriented programming

    The Romance World Cruise Line provides special gifts for passengers who are newlyweds, as well as for those who have been married more than 40 years. Design a pseudocode for a program that accepts a couple's last name, ship cabin number, and number of

    asked by Tom

    an electron is moving at 2x10^5 m/s through a uniform magnetic field of 1.4x10^-3 T.what is the magnitude of magnetic force if the velocity of the electron and the field make an angle of 45 degree.

    asked by please help w/ complete sol'n.
  77. Math

    A function has zeros of 5 and -1. If a horizontal translation is implemented, what is the least amount of transformation for both of the zeros to be positive integers? Is zero a positive integer?

    asked by Betty
  78. Algebra

    Using two lawnmowers and working together Tom and Anne can mow the lawn in 36 minutes. It takes Anne 90 minutes if she mows the lawn herself. How long would it take Tom to do the job working alone?

    asked by Julie
  79. English

    fill in the blank Which one of these careers ____ to six-figure salary? a. lead b. are leading c. leads d. have led c

    asked by Stephanie
  80. chemistry question

    how many moles of Ca, O and H are in .600 moles of Ca(OH)2?

    asked by ad
  81. science

    I want to do my msc project in clown fish. But i did not select an exact topic. Can you help me to select the topic?

    asked by madhumitha
  82. Quick Algebra Help

    write the sentence as an absolute value inequality. I have no clue how to do this! 1 a number less than 4 units from 0 2. a number is more than 11 units from 8 3. half a number is at least 2 units from 20

    asked by Hannah
  83. Maths

    An art and craft project require 42 pieces of wire. each length 1 4/7 feet. Assuring there is no waste in cutting, calculate the length of wire that should be purchased

    asked by Micholette

    A poor family with an income of $16,500 per year who purchase the average amount of lottery tickets for their income bracket?

    asked by MINDY
  85. Physics?

    consider two solid cones made from a uniform material. The smaller cone is a ½ scale model of the bigger one. They are released from equal height, quickly reach their terminal velocities and fall in air until they hit the ground. Use scaling reasoning to

    asked by Jay
  86. English

    Which of the following options best demonstrates sentence fluency? d. Walking down the street, I noticed how terrible the town looked among all the trash. b. The town looked terrible in that it was trashed by the tourists while I was walking down the

    asked by JR.
  87. Social Studies

    I'm having a hard time grasping the difference between a political issue and a global issue. Could you please explain each and give a few examples? Would animal rights fit into one of these categories?

    asked by Anonymous
  88. physics

    While curling, you push a rock for 1.70 m and release it when it has a speed of 2.40 m/s. It continues to slide at constant speed for 1.40 s and then hits a rough patch of ice. It finally comes to rest 7.20 m from where it was released. What was the

    asked by niro
  89. Physic

    Copy of Vector A has a magnitude of 9 and is at an angle of 30.4 degrees measured counter-clockwise from the x axis. Vector B has a magnitude of 12 and is at an angle of 102.3 degrees measured counter-clockwise from the x axis. Vector C has a magnitude of

    asked by elle
  90. math

    fred got a score of 84 on the test.write a division sentence using negative numbers where the quotient represents the number of questions fred answered incorrectly

    asked by die
  91. History

    What happened when the pueblos revolted against the spanish rule?

    asked by Anonymous
  92. Physic

    A quarterback (QB) is running at 3.2 m/s at an angle of 25 degrees with x axis as shown in the sketch. At the moment he's at the origin (x = y = 0) he throws the football to a receiver which is stationary located at the coordinates x = 10 meter, y = 6

    asked by elle
  93. Georgia state history

    which of the following actions does not describe land ownership in royal georgia? A: Women were allowed to own property.****** B: The largest land grants were limited to 500 acres. C: The headright system was used to determine the size of the grant. D:

    asked by Sara
  94. english

    The doctor who was late for an appointment dropped the x-rays into the puddle hurrying to the hospital. Which of the following is misplaced in the sentence above? a. Into the puddle b. Hurrying to the hospital c. Who was late d. For an appointment Hurrying

    asked by 1
  95. english

    Is the following sentence correctly punctuated? If not, what is the proper way to correct the sentence? Peter’s and Linda house is ugly. *** I would say NO. I think it should written as Peter and Linda’s house is ugly. ***

    asked by Anonymous
  96. math

    the product of seven and four times a number multiplied by three 28*n*3 is this correct??

    asked by penelope
  97. english

    1. I will have to purchase a new computer 2. I was informed that computers become outdated after a few years 3. I could not purchase replacement parts for my computer 4. My computer was not working correctly Using the sentence above, which of the following

    asked by Anonymous
  98. english

    The neighbors and ______ shared the cost of the storage rental. Which of the following options best completes the sentence above? a. me b. we c. her d. them we sounds good my reasoning: me shared the cost of the storage rental. does not make sense We

    asked by amy
  99. physics

    Copy of Vector A has a magnitude of 5 and is at an angle of 29.7 degrees measured counter-clockwise from the x axis. Vector B has a magnitude of 12 and is at an angle of 115.4 degrees measured counter-clockwise from the x axis. Vector C has a magnitude of

    asked by sally
  100. physics1

    Vector A has a magnitude of 6 and is at an angle of 32.4 degrees measured counter-clockwise from the x axis. Vector B has a magnitude of 12 and is at an angle of 113.8 degrees measured counter-clockwise from the x axis. Vector C has a magnitude of 17 and

    asked by sally
  101. Math

    Sherry saved $1800 she earned at her summer job. She invested part of her money in a Treasury Bill at 5% and the balance in a Money Market fund which guaranteed a return of 10%. If she earned $165 on her investments in the first year, how much was invested

    asked by Karl
  102. math

    Assume you have a basket full of socks, which have the following properties: 6 of the socks have blue stripes 8 of the socks have red polka dots 16 of the socks have blue polka dots 10 of the socks have red stripes (a). If you take one sock out of the

    asked by jordan
  103. biology

    In evolutionary terms, RNA is thought to have preceded proteins and DNA. Which of the following provides the most convincing support for this hypothesis? a. there are more types of RNA than there are of DNA b. RNA can both store genetic information and act

    asked by Tim
  104. math for managers


    asked by Anonymous
  105. Math

    1.-1/2+1/3= 2.-3 1/5+(-6 1/2)= 3.5/8-(-2/8)= 4.-9/10- 2/5 5.6 3/5-(-2 1/5)=

    asked by Bree
  106. Math

    If you save 1/5 of your allowance and spend 2/3 how much is left?

    asked by Sheri
  107. english

    Which of the following sentences correctly follows the rules of capitalization? a. The President of the company made a speech today b. I would love to spend my summers in the North c. He met with senator John Brown from Kansas d. My Grandfather told me

    asked by Mathew
  108. biology

    Which of the following is the key factor driving cellular differentiation in the body? a. chemical gradients in the cellular environment b. expression of genetic coding c. rate of transcription d. cellular nutritional status c? confused cuz transcription

    asked by help please
  109. Precalculus

    Find the domain of H(x)= (3x^2+x)/(x^2+4)

    asked by Joselito
  110. Math

    A recipe or trail mix calls for 1/4 cups of raisins, 1 1/2 cups of granola, 1/2 cup of mixed nuts, and 1/8 cup of chocolate chips. What fraction of each ingredient is required to make 5 1/2 recipes

    asked by Karen
  111. Physics

    What weight could be supported by a rotating object if it had a mass of 98 grams and if it were revolving in a horizontal circle, 50 cm diameter, and making 240 rev/min?

    asked by Talmadge
  112. Algebra

    I need help solving this please, divide the reciprical of -12 by -1/3

    asked by Fran
  113. physics

    A shuffleboard disk is accelerated at a constant rate from rest to a speed of 4.6 m/s over a 1.4 m distance by a player using a cue. At this point the disk loses contact with the cue and slows at a constant rate of 2.6 m/s2 until it stops. (a) How much

    asked by Hirak
  114. physics

    an object falls directly from a plane flying horizontally at an altitude of 10000ft at 50mi/h. how long will it take to hit the ground?

    asked by ayon
  115. math

    Pat worked 43 hours and received $7.25 per hour for regular pay and time-and-a-half for all hours over 40 hours. What were her weekly earnings?

    asked by rick
  116. social studies

    What may have caused religious disagreements amongst the colonist in colonial South Carolina? A- the capital only had an Anglican Church B-settlers weren't religious C-people did not go to church on Sunday D- all of the settlers belonged to the Anglican

    asked by :)
  117. MATH (vector addition)

    a swimmer able to move at 4 mph in still water in order to swim straight across a river from east to west with a southward current of 2 mph which direction should she swim?

    asked by Anonymous
  118. Math

    suppose you had a very small set of numbers that contained only 0 and 1 would this set be closed under addition? if not give a counterexample. please help me

    asked by penelope

    what is the proper name for C6H14?

    asked by Diana
  120. ohs

    Sara is six years older than Ben. Five years ago, Sara was one and a half times ad old ad Ben. What is Sara's current age? How did the teacher come up with Sara's current age of 23? I have no idea

    asked by john
  121. Maths

    A boy cycles 7.5km to school in 27½ minutes.Find his average speed in meters per second.

    asked by Awuni
  122. Calculus 1

    Find the derivative of the function. y=(e^3u -e^-3u)/(e^3u+e^-3u)

    asked by TayB
  123. Health

    the ________ is about the size of a walnut and encircles the urethra as it leaves the urinary bladder A- testis B- gonad C- thyroid gland D- prostate gland

    asked by Felicity
  124. English

    Posted by rfvv on Sunday, April 10, 2011 at 9:51pm. He asked me a question. He asked a question of me. He begged me a question. He begged a question of me. He inquired me a question. He inquired me of a question. (Are the pairs all correct and

    asked by rfvv
  125. Chemistry

    If the color of a silver nanoparticle remains constant, what does that tell you about the tendency of the particles to aggregate under those conditions? I think the particles won't aggregate, but I am not sure why. Is it because the atoms are moving at a

    asked by A
  126. Precalculus

    What is the conjugate of i+3?

    asked by Aziz
  127. math

    trevor paints 1/6 of the fence each day how many days will it take to paint 3/4 o the fence

    asked by jim
  128. maths

    Tsepo is 11/2meters tall. his father is 11/3meters times taller. how tall his father

    asked by Anonymous
  129. Data Management

    Suppose you have four squares of stained glass, all of different colours, and you wish to make a 2x2 square stained glass window. How many different windows are possible? (Note that any pattern may be rotated 180°, flipped vertically, or flipped

    asked by Arcjoi
  130. english

    Which of the following options best demonstrates sentence fluency? a. The city looked beautiful in that it was lit by the sun while I was walking down the street. b. Walking down the street in the sunshine, the city looked beautiful. c. The city looked

    asked by S
  131. Math

    A piece of wire is bent to form a square of area 121cm. Calculate: a)the length of each side of the square. b)the perimeter of the square. The piece of wire is now bent to form a circle using π=3.14 Calculate: a)the radius of the circle b)the area of the

    asked by Baller T
  132. Geometry

    ec bisects

    asked by Steve
  133. Biology

    How would you prepare 100 ml of the following aqueous solution: 25 mM TrisCl, 50 mM EDTA, 2% (w/v) NaCl, 5 X M9? You have been provided with stock solutions of 1 M TrisCl, 0.5 M EDTA, 25 X M9 and crystals of NaCl.

    asked by Madie
  134. BIO 12

    BIO 12 DNA DOUBLE HELIX. Hi, I'm having troubles understanding the following question(s) and was wondering if anyone could give me a hand? Original DNA Double Helix: TACGGGATACCGCCGTTCACACGT ( Starting From Left; Position #1 would be between the first A

    asked by Stephanie
  135. english

    Question #1 Is the following sentence written correctly? Yes or no? 1. “Hey,” he asked, “who are they?” 2. “No,” she said “that is not painful.” 3. “His mother, he said, “is taking night classes”. 4. “Mother,” he asked. “May I

    asked by Anonymous
  136. english

    Which of the following sentences is correctly punctuated? a.Education is our best tool for fighting ignorance: we should all educate ourselves. b.Education is our best tool for fighting ignorance; we should all educate ourselves. c.Education is our best

    asked by Anonymous
  137. science

    concentration of PbI ions in SLN saturated with PbI solid containing dissolved I- with a concentration of 0.085M

    asked by mavis
  138. Geometry

    asked by Sherrod
  139. chemistry

    consider the elements;Na,Mg,Cl and F.state with reasons,which element has the highest electronegativity. 2. Arrange with reasons, the elements in decreasing order of ionization energy

    asked by addo
  140. science

    True or False Mutation of germ cells can be inherited. True?

    asked by Q2
  141. English

    They sustained life threatening injuries in the forest fire, their names, ironically, are included on the list of suspected arsonist. How would you correct the sentence structure error? a. separate the two clauses with a colon b. join the two independent

    asked by Jerry
  142. science

    The bonds that holds atoms together in a molecule are a form of a. potential energy b. ionization energy c. kinetic energy d. thermal energy A?

    asked by Q2
  143. science

    does the liver have exocrine and endocrine functions? if so, what the functions? I don't think the liver has both exocrine and endocrine functions. I could be wrong. Someone kindly explain?

    asked by Anonymous


    asked by BONGA
  145. math

    Describe two ways you could evaluate 37% of the sum of 27 3/5 and 15.9. Tell which method you would use and why? THANK YOU!

    asked by Kyle
  146. Math

    Which number is grater than 5.5•10^-7 and less than 5.5•10^7? A. 1.8•10^-12 B. 6.7•10^8 C. 5.2•10^3 D. 3.9•10^-8 Is the answer C? Thank you

    asked by Skylar
  147. brebner

    (2)-Pule spent 3/4 out of an hour digging in the garden on Monday and 1 and 1 over three as long on Tuesday . How long did Pule spend digging on Tuesday

    asked by Anonymous
  148. Calculus

    Maclaurian' series example "f(x)=tanx" give me answer

    asked by Swapnil
  149. math

    can someone show me how to do these problems? Please? I really don't know how to answer them. I would really appreciate it... Solve the following formula for the variable indicated 9. r = d/t, where r = rate, d = distance, and t = time for d 10. 3x - y =

    asked by Abby
  150. Physics

    A sound wave with a frequency of 260 Hz moves with a velocity of 343 m/s through air. What is the distance from one condensation region (area of maximum pressure) to the next?

    asked by Tori
  151. Math

    A child's desk is made so that the dimensions are two-thirds the dimensions of a full-size adult desk. Suppose the top of the full-size desk measures 54 inches long by 36 inches wide. What is the perimeter and area of the topof the child's desk?

    asked by Richard
  152. physics

    My answer doesn't make sense. I will show question then my work: A city holding tank for water sits 20 m above the city. If a house was on fire 15 m away from the base of the holding tank, and the tank was originally filled to a depth of 15 m, to what

    asked by Jackie
  153. algebra

    please review the questions and table and check my answers. tank you tutors. table planets' orbital velocity planet orbital velocity (mi/s) mercury 29.74 venus 21.76 earth 18.5 mars 14.99 jupiter 8.12 saturn 6.02 uranus 4.23 solve. show your work. express

    asked by anon
  154. social studies

    2. What did the New England Colonies produce? How did this affect its economy? 3. What was the Mayflower Compact? How did it influence the representative government of the U.S? 4. What was the Fundamental Orders of Connecticut? How did it influence the

    asked by g
  155. Precalculus

    For f(x)=2x^2-4x+3 find f(x+h)-f(x)

    asked by Aziz
  156. Solving Linear Equations (Math)

    The length of a rectangle is 5m shorter than three times the width. The perimeter is 46m. Find the length of each side.

    asked by Andrea
  157. Precalculus

    Is (x+6) a factor of f(x)=2x^3+11x^2-7x+6?

    asked by Aziz
  158. hist

    analyze the north american bougeoise ideology between 1763 and 1783 how was the elite channeled the national american identity the amercan dream and the promise of the moral and social equality to gain the support of the white population to become

    asked by deb
  159. Geometry

    What is the pOH if the (OH-) is 1 x 10 -10 ? Please show your work? Plug the numbers into the formula

    asked by Randy
  160. CHEMISTRY !!! HELP !

    500.0 mL of 0.120 M NaOH is added to 595 mL of 0.250 M weak acid (Ka = 2.95 × 10-5). What is the pH of the resulting buffer? The answer that i got using HH equation is 4.14 but apparently it's wrong. Am I approaching this problem from a different angle ?

    asked by Owen
  161. Government

    I don't know im just confused how this question relates to government. Which of the following would a political party consider a “quality” candidate for national office? Question 3 options: A) An unknown mayor from Alaska. B) A self-employed computer

    asked by Jamie
  162. Math

    Sum of 3/4 + 1/3 _ _ 8 4 Simplest form

    asked by Sheri
  163. Math

    good day please help with this indefinite integral,especially what formula i can use to solve it-2x+1/(3x^2+3x+5)dx.Find the indefinite integral.

    asked by Butho
  164. english

    Question #1 Is the following sentence written correctly? Yes or no? 1. “Hey,” he asked, “who are they?” 2. “No,” she said “that is not painful.” 3. “His mother, he said, “is taking night classes”. 4. “Mother,” he asked. “May I

    asked by Anonymous
  165. Chemistry

    Dry air has a density of 1.29g/L (at 25 degrees celsius and 1 atm of pressure). How many liters would 500.g of this air occupy?

    asked by Mary
  166. Math

    What is the sum of 3/4 over 8 plus 1/3 over 4

    asked by Lacey
  167. kv

    a man travel 3 km north ,3 km east again 1 km north find the final displacement

    asked by khushii
  168. Chemistry

    How would you know if AgNO3 + Al(NO3)2 forms a precipitate?

    asked by Jacqueline
  169. Math

    Find the derivative: Write answers without negative or rational exponents. f (x)= 2 g (x) = 3x(4power)+ 6x(3power)-1

    asked by Lisa
  170. Language Arts

    I need to write to compare and contrast geology and etymology. How do I do that?

    asked by Kara
  171. Physics

    An 8 kg mass is supported by an aluminum wire of length 80 cm abd diameter 2.0mm. How much will the wire stretch?

    asked by Grace
  172. math

    can someone show me how to do these problems? Please? I really don't know how to answer them. I would really appreciate it... Solve the following formula for the variable indicated 9. r = d/t, where r = rate, d = distance, and t = time for d 10. 3x - y =

    asked by Abby
  173. physics

    My answer doesn't make sense. I will show question then my work: A city holding tank for water sits 20 m above the city. If a house was on fire 15 m away from the base of the holding tank, and the tank was originally filled to a depth of 15 m, to what

    asked by Jackie
  174. Science

    I need help understanding this. I keep re-reading and I'm still confused. Can you help me by re writing it in a way that I can understand? The pressure law states that for a constant volume of gas in a sealed container the temperature of the gas is

    asked by Learner
  175. physics

    the gravitational force on an object on the surface of the earth is F , what's the gravitational force on the satelite when at height R/20, where R is the radius of the Earth ?

    asked by edward
  176. CHEM

    PLEASE HELP! Two samples of sodium chloride were decomposed into their constituent elements. One sample produced 1.78 g of sodium and 2.74 g of chlorine. Which of the following could be the results of the decomposition of the other sample, being consistent

    asked by Diana
  177. Physics

    A certain car is capable of accelerating at a uniform rate of 0.83 m/s2 . What is the magnitude of the car’s displacement as it accelerates uniformly from a speed of 80 km/h to one of 92 km/h? Answer in units of m.

    asked by jon
  178. Reading/Language Arts

    Pedro looked at the roof and reminded himself to bring up a bucket of pitch next time to repair the new cracks. What does pitch mean in this sentence? What clues help you understand the meaning used in this sentence?

    asked by BUBBY
  179. aqua culture

    I want to my msc project on clown fish but i did not choose exact topic . Can you help me to find topics

    asked by madhumitha
  180. Math

    Explain how you know if a number can be divided evenly.

    asked by Syd
  181. Chemistry

    Calories to heat 8.1 g of water from 15 Celsius to 34 celsius

    asked by Famm

    sorry! this is the full question: Two samples of sodium chloride were decomposed into their constituent elements. One sample produced 1.78 g of sodium and 2.74 g of chlorine. Which of the following could be the results of the decomposition of the other

    asked by Diana
  183. English

    Is this passage plagiarized? I think so, because only the author's name is given and not the page number in the in-text citation. "...fathers brought forth on this continent a new nation, conceived in liberty and dedicated to the proposition that all men

    asked by Anonymous
  184. Reading/Language Arts

    Pedro knew that none of his neighbors would have to pitch tents and live in their yards while repairs were made to their homes. WHAT DOES PITCH MEAN IN THIS CONTEXT?? I DIDN'T FIND ANY DEFINITIONS ONLINE!

    asked by BUBBY
  185. Economics

    I really do not know what to do!:((( You are the marketing manager of the Bloomsbury Publishing that distributes the Harry Potter series. A new book is to be issued and you need to decide at which price it should be offered in US and European markets. On

    asked by Owly
  186. Math

    Dao has 2 and 3/8pounds of hamburger meat he is making 1/ 4 pound of hamburgers does doa have enough meat to make ten pounds

    asked by Niya
  187. science

    a student adds 3 spoons of salt to 100 ml of water. the solution is clear, with nothing on the bottom of the cup. one spoon of the slat ha a mass of 5g. what is the mass of the solution? after the water evaporates, what is the mass of the solid remaining

    asked by linda
  188. Physics

    Three boxes A, B, and C are placed on a frictionless surface as shown in the diagram below. If you push on box A with a force of 8.25 N, find the magnitude of the contact force between each pair of boxes. Here mA = 6.90 kg, mB = 3.80 kg, and mC = 1.50 kg.

    asked by Anonymous
  189. english

    Which of the following demonstrates proper subject-verb agreement? a. people who do not like to listen to themselves is rare. b. either the girl or the boy are going to select the car. c. each of the warm burgers are wonderful. d. the women with all of the

    asked by JR.
  190. Physics

    ou are helping your friend move a new refrigerator into his kitchen. You apply a horizontal force of F = +214i − 171k N to try and move the 64.0-kg refrigerator. The coefficient of static friction is 0.660. (a) How much static frictional force does the

    asked by Anonymous
  191. Pre Calculus

    The doubling period of a baterial population is 10 minutes. At time t=80 minutes, the baterial population was 50000 1What was the initial population at time t=0 2Find the size of the baterial population after 4 hours

    asked by Marina
  192. Physics

    A mover has to move a heavy sofa of mass 49.0 kg to the second floor of the house. As he pulls on the rope tied to the sofa, he makes sure that the rope is parallel to the surface of the ramp, which is at 30.0° to the horizontal. If the coefficient of

    asked by Anonymous
  193. Math

    Salon an was told the written paper on his science experiment should express measurements in liters. Which shows how to calculate the number of liters he used if he used 5 cups of water

    asked by Megan
  194. science

    A student adds 3 spoons of salt to 100 ml of water. The solution is clear with nothing on the bottom of the cup. One spoon of the salt has a mass of 5g. What is the mass of the solution? After the water evaporates what is the mass of the solid remaining in

    asked by linda
  195. preschool

    how does a preschooler even know how to post a question on jiskha? i mean really

    asked by (⊙_◎)
  196. physics

    During an Apollo lunar landing mission, the command module continued to orbit the Moon at an altitude of about 113 km. How long did it take to go around the Moon once?

    asked by kirsten
  197. History

    can someone help me, please?? I answered it once but my teacher said I needed to revise it. Here is the Question~~ 4) Starting in New England and working your way south, describe how each region saw settlers coming for different reasons. Give at least two

    asked by Abby
  198. College Algebra

    A wooden artifact from an ancient tomb contains 45% of the carbon-14 that is present in living trees. How long ago, to the nearest year, was the artifact made

    asked by Marina
  199. English

    Hello which sentence is correct? I'm not sure. as I had learned much from garfield high school. or I have learned much from Garfield high school. Should I use had or have? thank you

    asked by Kevin
  200. Chemistry

    how many gram of Cl are in475g of CaCl

    asked by Anonymous
  201. Biology

    2. Which macromolecules were present in your saliva

    asked by Shia
  202. Astronomy/Moon

    I understand a Tidal Cycle (new moon to new moon) averages about 29 Days 12 Hours 44 Minutes and 2.8 Seconds. It would therefore be reasonable to assume that the average time from Spring Tide to Neap Tide and vice versa will be 25% of the above (about 7

    asked by Mike
  203. chemistry

    based on the mass of lactose that you isolate from 1 mL of skim milk, calculate the percent composition of lactose in skim milk. mass of lactose= 0.28 grams

    asked by Anonymous
  204. physics

    A baseball player standing on the ground throws a ball straight up. The ball leaves the player's hand with a speed of 15.5 m/s and is in the air for 3.30 s before hitting the ground. How high above the ground was the baseball player's hand when he released

    asked by niro
  205. Noun

    physics: pls!!!!! i need ur help. in an experiment to verify Newton's law of cooling, the temperature of hot water in a calorimeter $T/^{o}C$ is plotted against time t/min. Which of the following is true about the graph? (a) The graph is linear and

    asked by basil