Questions Asked on
November 30, 2014

  1. Math

    b_n=(-2)^(n-1)

    asked by Edward
  2. trigonometry

    calculate the linear velocity of an object rotating at an angular velocity "w" at distance "r" from the center . express the answer in centimeter per second. 1.r=10cm; w=20πrad/second 2.r=5cm; w=20πrad/second 3.r=12cm; w=25πrad/second 4.r=30cm;

    asked by deyanz
  3. trigonometry

    please help me to solve this problem: calculate the angular velocity of a point for the given number of revolutions and time. express the answer on in radians per minute. 1.θ=1/2;t=2min. 2.θ=1/4;t=5min. 3.θ=2/3;t=10min. 4.θ=3/5;t=12min.

    asked by deyanz
  4. Algebra

    What is the probability of obtaining tails and a sis?

    asked by Maxine
  5. Chemistry

    Calculate the standard entropy, ΔS°rxn, of the following reaction at 25.0 °C using the data in this table. The standard enthalpy of the reaction, ΔH°rxn, is –44.2 kJ·mol–1. C2H4(G)+H20 ---> C5H5OH ΔS°rxn= ______ J*K^-1*mol^-1 Then, calculate

    asked by Patrick Panasko
  6. Calculus

    Determine the limit as x approaches 1 f(x) if f(x)={3-x, x does not equal 1 and 1, x=1 A. 2 B. 1 C. 3/2 D. DNE E. None of these

    asked by Anonymous
  7. marketing

    The types of companies compete in the global marketplace: (1) international firms, (2) multinational firms, and (3) transnational firms. All three employ people in different countries, and many have administrative, marketing, and manufacturing operations

    asked by nafees
  8. Calculus

    Find f'(x) for f(x)=(2x^2+5)^7 A. 7(4x)^6 B. 7(4x)^7 C. 28x(2x^2+5)^7 D. 7(2x^2+5)^6 E. None of these Would it be none of these because of the 4x in the chain rule?

    asked by Anonymous
  9. Calculus

    Find dy/dx if x^2+y^2=2xy A. x/(x-y) B. (y+x)/(y-x) C. 1 D. -x/y E. None of these Do I equal it to 0 and use implicit rule?

    asked by Anonymous
  10. introductory chemistry essentials

    A 3.5 Liter sample of 5.8 M NaCL solution is diluted to 55 Liter. What is the molarity of the new solution?

    asked by Anonymous
  11. Calculus

    Find limit as x approaches 1 5/(x-1)^2 A. 0 B. Negative infinity C. 5/4 D. Infinity If I use limit as h approaches 0 f(x+h)-f(x)/h , will I get an x in the answer?

    asked by Anonymous
  12. Math

    A game is played by throwing darts at a target. A player can choose to throw two or three darts. Darcy plays two games. In Game 1, he chooses to throw two darts, and wins if he hits the target at least once. In Game 2, he chooses to throw three darts, and

    asked by Anonymous
  13. Calulus

    Find f'(x): f(x)=(x^2-3x)/x^2 A. 2x-3/x^2 B. 2x-3/2x C. 1-(3/x) D. 3/x^2 E. None of these I can put it into the division rule for the derivative but get confused when I'm simplifying.

    asked by Anonymous
  14. Calculus

    Find limit as x approaches -1 (x^2+2x+3)/(x^2+1) A. 0 B. 1 C. Infinity D. DNE E. None of these

    asked by Anonymous
  15. Calculus

    Find the derivative for f(x)=-x^2+x Do I put the -x^2 as a denominator? How would I solve it if that's what I'm supposed to do?

    asked by Anonymous
  16. Chemistry

    A) if you added 8g of ammonium nitrate to 25mL of room temperature water, what would be the temperature in °C?

    asked by J
  17. Chemistry

    how many grams of ammonium nitrate would you have to add to 25mL of room temperature water to get 36°F?

    asked by Jay
  18. Calculus

    If f(x)=sin(2x), find f"(x) A. 2cos(2x) B. -4sin(2x) C. -2sin(2x) D. -4sinx E. None of these Is it B from using chain rules?

    asked by Anonymous
  19. Calculus

    If f(x) = {x^2+3x-1, x

    asked by Anonymous
  20. Calculus

    If f(x) = {x^2+3x-1, x

    asked by Anonymous
  21. Calculus

    Find limit as x approaches 5 (x^2-3x-10)/(x-5) A. 2 B. DNE C. 0 D. 7 E. None of these

    asked by Anonymous
  22. Calculus

    For which of these functions f(x) does limit as x approaches negative infinity f(x)=2 A. (x-2)/(3x-5) B. 2x/sqrt(x-2) C. (2x^2-6x+1)/(1+x^2) D. (2x-1)/(x^2+1) E. None of these

    asked by Anonymous
  23. AP calculus

    Find values for x and/or y on the graph of x^2-2y^2+9x+8y-276=0 for which there is a vertical tangent line

    asked by DJjazzyjazz
  24. Calculus

    Find an equation of the tangent line to the graph of f(x)=xsinx when x=0. A. y=0 B. f'(x)=0 C. y=xcosx+sinx D. y=x E. None of these

    asked by Anonymous
  25. Calculus

    Find dy/dx for y=sin(x+y) A. 0 B. (cos(x+y))/(1-cos(x+y) C. cos(x+y) D. 1 E. None of these I know I'm supposed to use implicit differentiation but I'm not sure how to go about it with sin

    asked by Anonymous
  26. Math

    if f(x) = 2x^2+4 and g(x)=x-3 which number satisfies f(x)= (f o g)(x) A) 3/2 B) 3/4 C) 5 D) 4 I am positive that answer A is correct, i just cant get the work to prove it, i can disprove all other answers and my teacher has assured me i am on the right

    asked by Katie
  27. physics

    a car is running at 50 mph when the driver starts to step at the breaks. if the car decelerates at the rate of 7 ms^2, how long does it take the car stop?

    asked by ynah
  28. physics

    a body moving at 40 m/s accelerates at the rate of 8m/s^2. what is the distance it transverses in 15 seconds?

    asked by ynah
  29. Trigononometry and plaine sperical

    Find the exact values of the six trigonometric functions for each of the following angles.draw the angles in standard position 1.300 degree

    asked by Jomar castillo
  30. Calculus

    Find d^2y/dx^2 for y=(x+3)/(x-1) A. 0 B. y=-8/(x-1)3 C. y=-4/(x-1)^3 D. y=8/(x-1)^3 E. None of these I got a positive number but am not sure about the denominator in the second derivative.

    asked by Anonymous
  31. Physical Education

    What traditions have grown around baseball?

    asked by Just Wondering
  32. Calculus

    Which of the following describes the graph of y=|2x+6|? A. Only continuous B. Only differentiable C. Both A and B D. Not continuous, not differentiable E. Constant

    asked by Anon
  33. Physics

    A hollow sphere has a mass of 15 kg, an inner radius of 12 cm and an outer radius of 18 cm. What is the rotational inertia (moment of inertia) of the sphere about an axis passing through its center?

    asked by Mike
  34. physics

    a 20 kg traveler's bag is being pulled along the floor with a force of 50 NF. the force is applied on the handle forming an angle of 30 degree with the horizontal. neglecting friction,what is the acceleration og the bag? How much force is exerted by the

    asked by jhon
  35. Calculus

    Find f'(x) if f(x)=sin^3(4x) A. 4cos^3(4x) B. 3sin^2(4x)cos(4x) C. cos^3(4x) D. 12sin^2(4x)cos(4x) E. None of these I got D using the chain rule?

    asked by Anonymous
  36. Calculus

    If f(1)=4 and f'(1)=2, find an equation of the tangent line at x=1 A. y=2x+2 B. y=2x-2 C. y=4x-7 D. y=4x-2 E. None of these

    asked by Anonymous
  37. Math

    ABC *AA Ans: AC6C Find ABC values?

    asked by Kamalakshi
  38. trigo

    a peak is sighted at an angle of 27 degree 45 min. 1000ft nearer its angle of elevation is 31 degree 30 min.find the height of the peak

    asked by chel
  39. math

    A prism has a base which is a right triangle with legs, 16mm and 12 mm

    asked by sawsdas
  40. physics

    An unknown mass of a certain solid, initially at 60⁰C, is heated at a uniform at a uniform rate. After 4.0 min the solid reaches its melting point of 80⁰C, and it remains at that temperature for 3.0 min until completely melted. After a further 6.0 min

    asked by Alicia
  41. Solid Mensuration

    A circle having an area of 452 square inches is cut into two segments by a chord, which is 6 inches from the center of the circle. Find the area of the bigger segment.

    asked by Sol
  42. Solid Mensuration

    The area of a regular hexagon inscribed in a circle is equal to 166.28 square cm. If the circle is inscribed in a square, find the difference between the area of the square and the hexagon.

    asked by Sol
  43. statistics

    A company has been studying the performance of their sales department. The measure of performance used is: average monthly sales amount in dollars. For the past 12 months, the average monthly sales amount has been $4,532 with a standard deviation of $386.

    asked by Deeptimaan
  44. statistics

    An air gap exists between fluids in a bottle and the cap of the bottle. At a firm producing olive oil, the gap is critical to the shelf life of their product. If the recent information reveals that the average gap is 9.46 mm with a standard deviation of

    asked by Deeptimaan
  45. Gowng

    The speen of a bullet of mass 20g in 216km/s what is kinetic energy

    asked by Shedrack
  46. English

    How to find a keywords of the quote our deepest fear

    asked by Anonymous
  47. physics

    a force of 10n cause a spring to extened by 20 mm find? the extension of the spring when 25n is applied

    asked by mubarak
  48. government

    . In Griswold v. Connecticut, the Supreme Court was considered an activist court because... I know that it has everything to do with the privacy law. I am stuck between two answer from the multiple choice. please help.

    asked by Sunflower
  49. physics

    a projectile has a maximum range R=150m.find its initial velocity and the corresponding maximum height it reaches. at what angle should it be aimed to hit a target at the same level that is located at a distance x=100m from it?

    asked by ali
  50. physics

    an object moves horizontally with a velocity v=20m/s with constant acceleration a=2m/ss.how faar does it move before its velocity is doubled?

    asked by ali
  51. Biology

    Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC

    asked by Jessica
  52. English

    Comparisons between Lady Macbeth and Juliet + some quotes to explain the comparisons

    asked by Hifza
  53. What is the best estimate of the population mean?

    The Jolliebee hamburger chain specializes in half-pound hamburgers. The sales follow a normal distribution. The standard deviation of the distribution for daily sakes is $3000. A sample of 40 showed the mean daily sale to be $20,000. What is the best

    asked by Jennifer
  54. physics

    A river is flowing along the east direction with a velocity of 10km/hr. A person heads towards north with a velocity of 2km/hr. what is the velocity of the person with respect to ground?

    asked by shreya
  55. math

    Kendra has a painting canvas that is 27 inches wide by 33 inches high. She painted a red rose, which covered 40% of the canvas. What was the area of the canvas which was covered by the red rose?

    asked by jamie
  56. pre-cal

    Find the height of a ball after 3 seconds, if the ball is hit with an initial velocity of 90 feet per second at an angle of 60 degrees from an initial height of 5 feet.

    asked by Anonymous
  57. math

    Find the height of a ball after 3 seconds, if the ball is hit with an initial velocity of 90 feet per second at an angle of 60 degrees from an initial height of 5 feet.

    asked by Anonymous
  58. Biochem

    I did a titiration expriment and I need to work out how much Hcl is in the sample (NaOH). The expriment was testing the rate of ester hydrolysis . I was wondering if the the amount of Hcl present is the same as NaOH added due to the equivalence of the acid

    asked by annnnnnnnnnnnnnnnnn
  59. physics

    A dude is spinning a 1.0 kg mass on the end of a 1.5 meter string. He gets it spinning at a constant rate of 4.0 rev/sec. The string breaks such that the mass is thrown into projectile motion with an initial angle of 45° to the ground (assume that it is

    asked by hicham
  60. percentages

    a tree is 1.5 m tall after a year it increase its height by 12% after another year it by a further 14% what is the percentage change

    asked by anyomonous
  61. SIXTH GRADE MATH

    The ratio of wins to losses for a basketball team is 2:3. Which of the following is a possible total number of games? A. 7 games B. 14 games C. 25 games D. 26 games Can someone show me how to solve this problem please?

    asked by Stephon
  62. Math

    Robyn and Shruti both run on the cross country team. Robyn runs 2 miles every day. Shruti starts her week with a 3-mile run and runs 1 mile every day, even on the day she runs the 3 miles. If M is the number of miles run during the week, and d id the

    asked by Jamar
  63. SIXTH GRADE MATH

    The staff of the Westpoint Public Library signed up 6 volunteers in the last 21 days. If the library staff continues to sign up volunteers at this rate, how many new volunteers will they get in the next 7-day week? 2 volunteers is my answer. Is my answer

    asked by Stephon
  64. Calculus (cross section)

    A solid has a base bounded by x^2_y^2=36. Find the volume of the solid if every plane section perpendicular to the diameter is an isosceles triangle whose base is on the circle and whose height is 4 units

    asked by Trinh
  65. SIXTH GRADE MATH

    The ratio of boys to girls at a day care cent is 5 to 4. Which of the following cannot be the total number of children at the center? A. 27 children B. 54 children C. 60 children D. 72 children Is the answer 60. The reason I chose 60 children is because

    asked by Stephon
  66. Calculus (Cross Section) again

    A half of a pepperoni stick is 10 cm long. Assume that a cross section perpendicular to the axis of the pepperoni at a distance x from the end if a circle of radius rad(3x). What is the volume of the pepperoni

    asked by Trinh
  67. math

    Tarot cards are used for telling fortunes, and in a reading, the arrangement of the cards is as important as the cards themselves. How many different readings are possible if five cards are selected from a set of nine Tarot cards?

    asked by libby
  68. math

    Evaluate the expression. 11! 6! 4! 2! 3! 1!

    asked by libby
  69. Calculus

    Find the equation of the line that passes through (1,3) and is perpendicular to the line 2x+3y+5=0 A. 3x-2y+3=0 B. 2x+3y-11=0 C. 2x+3y-9=0 D. 3x-2y-7=0 E. None of these I got E?

    asked by Anonymous
  70. Calculus

    Find an equation of the tangent line to the graph of x^2+3y^2=4 at the point (1,1) A. y+1=-1/3(x+1) B. y-1=-x/3y(x-1) C. x+3y=2 D. y-1=-1/3(x-1) E. None of these

    asked by Anonymous
  71. Calculus,reaction rates

    A car starting at 12:00 noon travels west at a speed of 30 kph. Another car starting from the same point at 2:00 PM travels north at 45 kph. Find how fast the two are separating at 4:00 PM?

    asked by @jayr
  72. Calculus

    Find the derivative of x^2f(x) A. x[xf'(x)+2f(x)] B. 2xf'(x) C. x[xf'(x) +2f'(x)] D. x^2f'(x) E. None of these

    asked by Anonymous
  73. AP Calculus

    Let f(7)=0, f'(7)=14, g(7)=1, g'(7)=1/7. Find h'(7) if h(x)=f(x)/g(x)

    asked by Sarah
  74. Calculus,Reaction rates

    A man walks across a bridge at the rate of 5 ft/s as a boat passes directly beneath him at 10 ft/s. If the bridge is 10 ft above the boat, how fast are the man and the boat separating 1 second later?

    asked by ray
  75. Calculus

    Find the limit as x approaches 0 [(sqrt(x+9))-3]/x A. 0 B. 1 C. Infinity D. 1/3 E. None of these

    asked by Anonymous
  76. Chemistry

    The addition of a crystal of sodium chlorate to a sodium chlorate solution containing no undissolved solute causes additional crystals of sodium chlorate to precipitate. The original solution was supersaturated or unsaturated

    asked by Ang
  77. PROPORTION - MATHS

    In a Map a distance of 50KM between two places A and B represented by 4m. What will be the actual distance between A and C, represented on the map considered as 7cm? 50:4 :: 7:x 50x : 4 X 7 x = 4 X 7 / 50 = 7/12.5 Please varify this question.

    asked by niya
  78. AP Calculus

    Find all points on the graph of f(x)=-x^3+3x^2-2 where there is a horizontal tangent line.

    asked by Sarah
  79. Calculus

    If f(x)=x^2+1 and g(x)=2x-1, find d/dx[f'(g(x))] at x=1 A. 2 B. 6 C. 4 D. 0 E. None of these

    asked by Anon
  80. statistics

    A 4 to 7 month old baby sleeps an average of 14 hours per day. At this age, babies sleep patterns follow normal distribution with the standard deviation of 1.6 a) is it unusual for a baby to sleep under 12 hours aday? b) In a random sample of 10 babies of

    asked by adriana
  81. statistics

    A 4 to 7 month old baby sleeps an average of 14 hours per day. At this age, babies sleep patterns follow normal distribution with the standard deviation of 1.6 a) is it unusual for a baby to sleep under 12 hours a day? b) In a random sample of 10 babies of

    asked by adriana
  82. Calculus

    Find the derivative: f(x)=1/cubed root(3-x^3) A. -1/3(3-x^3)^4/3 B. x^2/(3-x^3)^4/3 C. -x^2/(3-x^3)^2/3 D. -x^2/(3-x^3)^4/3 E. None of these

    asked by Anonymous
  83. CALC 1

    Suppose that h is a function with h'(x) = xe^x. Find all intervals where the function h is concave up. Now, I understand that concavity is determined by the second derivative, so what my question here is, is it just taking the first derivative and then

    asked by Brian
  84. biochem

    How can I convert a rate constant from mol to t/M.I have 0.00012 mol of AcH present at 5min .Know I want to calculate the concentration at this time ( [AcH]t / M ) . How would I work this out .Please help this is for a lab writeup for tomorrow .

    asked by Becky
  85. statistics

    A simple random sample of students is selected, and the students are asked how much time they spent preparing for a test. The times (in hours) are as follows: 1.3 7.2 4.2 12.5 6.6 2.5 5.5 Based on these results, a confidence interval for the population

    asked by Brian
  86. physics

    Ben uses a parachute, to fall to the ground at a safe, steady speed. Discuss the energy transfers, which allow ben and his parachute, to drop at a steady speed.

    asked by olivia
  87. Statistics

    A recent study of US children under 11 years old found that they spend on average 142 minutes a day watching tv. Assuming normal distribution with the standard deviation of 44 minutes, answer the following. A) what percent of children of this age spends

    asked by Junior
  88. biochem

    How can I convert a rate constant from mol to t/M.I have 0.00012 mol of AcH present at 5min .Know I want to calculate the concentration at this time ( [AcH]t / M ) . How would I work this out .Please help this is for a lab write up for tomorrow .

    asked by Becky
  89. AP Calculus

    Find limit as x approaches 1 5/(x-1)^2 A. 0 B. Negative infinity C. 5/4 D. Infinity E. None of these

    asked by Anon
  90. English

    similarities and differences between lady macbeth and juliet

    asked by Rais
  91. math

    Sean has 8-inch pieces of toy train track and Ruth has 18-inches of train track. How many of each piece would each child need to build tracks that are equal in length?

    asked by Anonymous
  92. chem

    The Ka of an acid is 6.3 x 10-8. To the nearest one hundredth, what is its pKa

    asked by jess
  93. social studies

    in Greek education why is it beneficial to educate all children in a civilization? why is it important to educate the population in a democracy?

    asked by Daniela
  94. calc

    evaluate the surface integral double integral (y dS) z= 2/3 (x^3/2 + y^3/2) 0 ≤ x ≤ 5, 0 ≤ y ≤ 2

    asked by sara
  95. chem

    A weak acid, HA, has an ionization constant of 9.29 x 10-6. If we prepare a solution that is 0.727 M in HA what percent of the acid will be ionized?

    asked by jess
  96. Math

    Which of the expressions is not equivalent to 1/25? A. 5^3×5^-5 B. 5^-1×5^-1 C. 5^-3×5 D. 5^-2×5^4

    asked by Anon
  97. science

    what is pollution

    asked by Anonymous
  98. English Poetry(response to writeacher)

    The theme is the theme is thoughts of elderly? And that there is only one life to live so live it well? This poem seems confusing.. it is either really easy and literal or metaphoric.. I need to write a paper on the atmosphere of this poem and I think the

    asked by Bethany
  99. Social studies

    -Athens does not live up to Pericles ideal democracy because Athenians use of ostracism contradicts Pericles statement that all have equal participation - Athens somewhat lives up to Pericles ideal democracy because it only allowed native born, male

    asked by Nicole
  100. physics

    How much heat (in kJ) will it take to bring 56 kg of ice at -8°C to dry steam? Answer to 3 significant figures

    asked by Anonymous
  101. math

    The ratio of cups of water to cups of milk in a recipe is 1 to 3. Write three ratios equivalent to the ratio?

    asked by jordon
  102. geometry

    Having a very hard time. Can someone please help. Im trying to find how many sides a polygon has if, the difference of the interior and exterior angles is 100 degrees?

    asked by Brandi
  103. Physics

    The acceleration of gravity is 9.8 m/s^2 . What is the magnitude of the total force on a(n) 72 kg driver by the dragster he operates as it accelerates horizontally along a straight line from rest to 61 m/s in 7.8 s? Answer in units of kN

    asked by Jackie
  104. ap calc

    what is 2+2

    asked by Bro
  105. biochem

    How can I convert a rate constant from mol to t/M.I have 0.00012 mol of AcH present at 5min .Know I want to calculate the concentration at this time ( [AcH]t / M ) . How would I work this out .Please help this is for a lab writeup for tomorrow .

    asked by becky
  106. AB Calculus

    I figured out that part "A" is -3/8, but i can't figure out part 2, a or b. please explain and help. thanks. Sand is falling from a rectangular box container whose base measures 40 inches by 20 inches at a constant rate of 300 cubic inches per minute. a)

    asked by Jake
  107. Physics

    A 4.26 kg block starts up a 33.0 degree incline at 7.81 m/s. How far will it slide if the coefficient of kinetic friction is 0.23?

    asked by Jennifer
  108. ApWorld history

    Would Arabic becoming an important language count as a change to the spread of islam in a ccot essay

    asked by Anonymous
  109. Algebra

    (7.8*10 to the 12th power)*800=(7.8*10 to the 10th power)*80,000 Directions:tell whether each equation is true or false. if false, write the inequality in like terms I don't remember how to start multiplying.

    asked by Bob
  110. Physics

    A child of mass m is playing on a merry-go-round which has mass 6m and radius r. Assume the merry-go-round is a uniform disk. The child is standing on the edge of the merry-go-round, which is spinning with an angular speed ω1. a) What is the moment of

    asked by Alex
  111. AP Calculus

    Find f'(x): f(x)=(x^2-3x)/x^2 A. 2x-3/x^2 B. 2x-3/2x C. 1-(3/x) D. 3/x^2 E. None of these I get confused on the simplifying part.

    asked by Anon
  112. physics

    When a 1.50 kg block is 3.96 m above the base of the hill, the mass has a speed of 1.71 m/s. When the block reaches a point 0.750 m above the base of the hill, what is its kinetic energy?

    asked by Steve
  113. Calc

    Find the linearization of f(x)=cos(x)-sin(2x) at x = 0.

    asked by Fred
  114. Calculus

    Find limit as x approaches -1 (x^2+2x+3)/(x^2+1) A. 0 B. 1 C. Infinity D. DNE E. None of these

    asked by Anonymous
  115. AP Calculus

    Find the derivative for f(x)=-x^2+x Do I put -x^2 on the denominator? How would I solve it if that's the case?

    asked by Sarah
  116. physics

    How much work is required to extend an exercise spring 15cm if the spring constant is 800N/m?

    asked by Leah
  117. Religion/ Social Studies/ Science

    Please, someone tell me who was it that made the world. Thank you.

    asked by sharkeesha
  118. science

    A jellyfish can propel itself with jets of water pushed out of its bell, a flexible structure on top of its body. The elastic bell and the water it contains function as a mass-spring system, greatly increasing efficiency. Normally, the jellyfish emits one

    asked by Jason
  119. Calculus

    Find limit as x approaches 5 (x^2-3x-10)/(x-5)

    asked by Anonymous
  120. Statistics

    A popular resort hotel has 300 rooms and is usually fully booked. About 4% of the time a reservation is cancelled before 6:00 PM deadline with no penalty. What is the probability that at least 280 rooms will be occupied? Use binomial distribution to find

    asked by Richa
  121. physics

    A robot arm expends 15J of work to extend a spring 10cm from its equilibrium position. How much force is required?

    asked by Leah
  122. physics

    with what speed does a hammer dropped from a height of 23 m strike the ground?

    asked by Leah
  123. Physics

    A puck (uniform disk) of mass m and radius r is travelingat a speed v on frictionless ice. It strikes a second identical puck a glancing blow (at point P) and sticks to it (using VelcroTM). After the collision, the two-puck-object rotates with angular

    asked by Alex
  124. math

    the ratio of boys to girls on the bus is 20/15. what are three ratio equivalents.

    asked by jordon
  125. Chemistry

    Consider the reaction for the production of NO2 from NO: 2 NO(g) + O2(g) = 2 NO2(g) a)If 84.8L of O2(g), measured at 35 degrees Celsius and 632mm Hg, is allowed to react with 158.2g of NO, find the limiting reagent. b) If 97.3L of NO2 forms, measured at 35

    asked by Kirsty
  126. chemistry

    Determine how many milliliters of 0.310 M HClO4 will be required to neutralize 52.37g Ca(OH)2 according to the reaction: 2HClO4 + Ca(OH)2 ---> Ca(ClO4)2 + 2 H2O

    asked by B
  127. Please answer

    An agricultural researcher is interested in estimating the mean length of the growing season in a region. Treating the last 10 years as a simple random sample, he obtains the following data, which represent the number of days of the growing season. 153 164

    asked by STATS 2
  128. AP calc

    . If f(x) = {x^2+3x-1, x

    asked by Anon
  129. Math Stats

    The following data represent the asking price of a simple random sample of homes for sale. Construct a 99% confidence interval with and without the outlier included. Comment on the effect the outlier has on the confidence interval. Here is the information:

    asked by STATS 3
  130. Algebra word problem

    Mary is two years older than Robert. The sum of their ages is 28. Write an expression for each person, write the equation for the situation and find out how old each person is.

    asked by Lee Ann
  131. Physics

    A 50 kg cart rests on frictionless surface. A net force of 75 N acts on the carts over a distance of 2m. What maximum speed does the cart reach? Work: I can figure that the acceleration is 1.5m/s/s, Vi= 0. I was thinking maybe if I found time through the

    asked by Sam
  132. Math Stats

    The following data represent the age (in weeks) at which babies first crawl based on a survey of 12 mothers. 52, 30, 44, 35, 47, 37, 56, 26, 35, 35, 52, 52 __________________________________________________________________________ Construct a 95%

    asked by STATS 4
  133. Chemistry Correction

    Hi, I'm trying to solve for the radius of the sphere. This is the correct steps: 8.27*10^-29 = 4/3 pi * r^3 r^3 = 2.0225 * 10^-29 cu meters When I do 8.27x10^-29 / 4/3 pi, I don't get the answer 2.0225x10^-29 Can you tell me what I'm doing wrong?

    asked by Nancy
  134. AP Calculus

    For which of these functions f(x) does limit as x approaches negative infinity f(x)=2 A. (x-2)/(3x-5) B. 2x/sqrt(x-2) C. (2x^2-6x+1)/(1+x^2) D. (2x-1)/(x^2+1) E. None of these

    asked by Sarah
  135. ApWorld history

    How did religion stay the same throughout the spread of islam in west Africa in circa 800 C.E. and circa 1750

    asked by Anonymous
  136. chemistry

    A 0.205 g sample of impure NaOH requires 17.5 mL of 0.2180 M HCl for neutralization. What is the percent of NaOH in the sample, by weight?

    asked by Kate
  137. English

    1. I heard the news at first hand. 2. I heard the news at second hand. 1-1. I heard the news directly. 2-2. I heard the news indirectly. --------------- Are they interchangeable? What is the meaning of 'hand' in the sentences?

    asked by rfvv
  138. math

    Sinea and Ren are going to the carnival next $8, souvenirs - $20 Sinea wants to spend money using the same ratios as on her last trip to the carnival. If she spends $26 on games, how much will she spend on souvenirs? Ren wants to spend money using the same

    asked by jordon
  139. CHEMISTRY HELP

    what are the diff b/in: 12. Dilute to and dilute with 13. Warm, boil 14. Heat almost to boiling 15. Heat just to boiling 16. Evaporate to 17. Evaporate to almost dryness 18. Concentrate the volume to 12. I know the meaning of dilute its reducing the

    asked by Yeng
  140. geography

    How did the geographers decide the 6main cultures

    asked by Christal
  141. Spanish Help

    Si yo _________ (omitir) algo en esta carta, lo siento. a.omitimos b.omiten c.omito d.omites I know omitir means skip, and I know what the sentence says. I wanted to know if anyone could find me anything helpful when it comes to -IR verbs? I do not get the

    asked by Katt<3Bobby
  142. Chemistry

    What volume of H2 gas (in liters), measured at 23 °C and 678 torr, can be obtained by reacting 7.59 g of zinc metal with 124 mL of 0.302 M HCl? Zn + 2HCl --> ZnCl2 + H2

    asked by KJ
  143. Calculus

    The slope of the line tangent to the curve xy+(y+1)^2=6 at the point (2, 1) is

    asked by James
  144. math

    the ratio of girls to boys in the chorus is 3:2. If there are 50 students in chorus, how many boys are there and how many girls?

    asked by terry
  145. @Vanessa: Re: Comm/215

    I deleted your original questions and answers. Here are my responses. Comm/215 - Ms. Sue, Sunday, November 30, 2014 at 4:45pm I've checked the first 10 and they are all right. Is # 11 a comma splice? If I have time, I'll come back and check more of your

    asked by Ms. Sue
  146. Help with differential eqs problem???? (Calculus)

    Consider the differential equation dy/dt=y-t a) Determine whether the following functions are solutions to the given differential equation. y(t) = t + 1 + 2e^t y(t) = t + 1 y(t) = t + 2 b) When you weigh bananas in a scale at the grocery store, the height

    asked by Stacey
  147. math

    Tina says that 6:8 is equivalent to 36:64. What did Tina do wrong?

    asked by eugene
  148. maths

    April has 3 pounds of trail mix. She puts equal of amounts in each of 8 bags. How much trail mix is in each bag?

    asked by ann
  149. STATS MATH 1

    A nutritionist wants to determine how much time nationally people spend eating and drinking. Suppose for a random sample of 1065 people age 15 or older, the mean amount of time spent eating or drinking per day is 1.62 hours with a standard deviation of

    asked by LADO
  150. Math

    1. If 100 is saved on October 1, 150 on October 2, 200 on October 3, and so on, how much is saved during October? 2. A Ping-Pong ball is dropped from a height of 16 ft and always rebounds 1/4 of the distance of the previous fall. a. What distance does it

    asked by Hershey
  151. MATH

    The following data represent the asking price of a simple random sample of homes for sale. Construct a 99% confidence interval with and without the outlier included. Comment on the effect the outlier has on the confidence interval. Here is the information:

    asked by LADO
  152. Chemistry (Titrations)

    In order to standardize a KMnO4 solution, 0.2848 g Fe(NH4)2(SO4)2·6H2O was dissolved in 25 mL 0.18 M H2SO4. The KMnO4 solution was added to the Fe(NH4)2(SO4)2·6H2O solution until a pale pink color persisted. The titration took 24.2 mL of KMnO4 solution.

    asked by Bill
  153. Math

    1. A town has a population of 100,000 now and the population is increasing 10% every year. What will be the population in 5 years? 2. How many poles will be in a pile of telephone poles if there are 30 in the bottom layer, 29 in the second, and so on,

    asked by Hershey
  154. English (Urgent)

    In John Cheever's story reunion, what do the restaurants symbolize. Why does Charlie call hi father daddy at the end of the story? Examine the first and last sentences of the story. What is common and why? How do you interpret the ending of the story? Does

    asked by Aly
  155. Chemistry

    Bromine has two naturally occurring isotopes, the first of which is 79Br with a mass of 78.904 amu and an abundance of 50.54%. Calculate the mass of the other isotope.

    asked by Louise
  156. Math please help!

    A glass of skim milk supplies 0.1 mg of iron, 8.5 g of protein, and 1 g of carbohydrates. A quarter pound of lean red meat provides 3.4 mg of iron, 22 g of protein, and 20 g of carbohydrates. Two slices of whole-grain bread supply 2.2 mg of iron, 10 g of

    asked by Steve
  157. Calculus

    Suppose that represents the temperature of a cup of coffee set out in a room, where T is expressed in degrees Fahrenheit and t in minutes. A physical principle known as Newton’s Law of Cooling tells us that dT/dt = -1/15T+5 15T + 5. a) Supposes that T(0)

    asked by Bridget
  158. Chemistry

    I'm looking for a video of a chemical reaction that can help me answer these questions What are the names of the reactants and products and their states @ room temperature? What type of reaction is it?

    asked by Anonymous
  159. band essay?

    I have to write an essay on why I deserve a scholarship for our band class trip to Puerto Rico, I was wondering what English teachers would be looking at/for in this essay and how long it should roughly be

    asked by Anonymous
  160. chemistry

    If you place 10.0 L of propanol (C3H8O) in a sealed room that is 3 m long, 2.75 m wide, and 2.5 m high, will all the propanol evaporate? If some liquid remains, how much will there be? The vapor pressure of propanol is 10.7 torr at 25 °C, and the density

    asked by chris
  161. Math

    A triangular region is bound by the three lines 2x+y-12=0, y=3x-3, and y=1/7x-81/7. What is the circumcentre of this triangle? I can find the answer using a graph, but I don't know the formula to find the mid segments of the lines.

    asked by Annabeth
  162. ps316

    There 112 seats there 7 seats in each row and 70 people are seated how many rows are empty

    asked by janice
  163. Calculus with Diffrential Equations: Pleease help?

    Suppose that represents the temperature of a cup of coffee set out in a room, where T is expressed in degrees Fahrenheit and t in minutes. A physical principle known as Newton’s Law of Cooling tells us that dT/dt = -1/15T+5 15T + 5. a) Supposes that T(0)

    asked by Bridget
  164. Chemistry

    To 1.0 ml of 1.5%NaCl, water is added to a final volume of 100ml. What is the molarity NaCl of this final solution? 1.5g/100ml I do not know where to go from here?

    asked by Samantha
  165. physics

    Two boys stand on the surface of a frozen lake where μs = 0.15 and μk = 0.10. The 30.0 kg boy shoves the 40.0 kg boy with a horizontal force of 50.0 N, 0.0°. Find the resulting acceleration of each boy.

    asked by Mush
  166. chemistry-chemical equations

    How do I write the balanced chemical equation for Copper +nitric acid -> copper(II)nitrate+ nitrogen dioxide + water

    asked by Anonymous
  167. algebra

    You must submit your response as a file. An object’s weight depends on its height above the surface of the earth. If a man weighs 190 pounds on the surface of the earth, then the man's weight in pounds (W) x miles above the surface is approximated by the

    asked by darlene
  168. business

    New Orleans’s Mt. Sinai Hospital is a large, private, 600-bed facility complete with laboratories, operating rooms, and X-ray equipment. In seeking to increase revenues, Mt.Sinai’s administration has decided to make a 90-bedadditiononaportionofadjacent

    asked by business
  169. MATH

    The following data represent the asking price of a simple random sample of homes for sale. Construct a 99% confidence interval with and without the outlier included. Comment on the effect the outlier has on the confidence interval. Here is the information:

    asked by LADO
  170. falaq

    Assalamualaikum Muslim experts in falaq have produced salat timetables for the convenience of the ummah. a.Naturally they would have certain error margins.If, say for example the error is about 2 minutes. The time for asr is 430 pm. Is it then possible to

    asked by nadira
  171. Algebra

    A confectioner sells two types of nut mixtures. The standard-mixture package contains 100 g of cashews and 200 g of peanuts and sells for $1.85. The deluxe-mixture package contains 150 g of cashews and 50 g of peanuts and sells for $2.45. The confectioner

    asked by Jessica
  172. Algebra

    A woman wishes to invest $12,500 in three types of bonds: municipal bonds paying 8% interest per year, bank investment certificates paying 9%, and high-risk bonds paying 12%. For tax reasons she wants the amount invested in municipal bonds to be at least

    asked by Jessica
  173. Geometry

    Draw a pentagon shaped courthouse, it must be painted. Each wall of the courthouse is 80ft by 18ft. Problem:

    asked by Kiara
  174. Math

    A town has 4900 registered voters, each of whom is either a Republican, a Democrat or an Independent. In the last primary election, 1150 people voted, and the number of Republicans who voted was 720 fewer than 30% of the total number of Democrats plus

    asked by Kyle
  175. Chemistry

    5.) Which of the following is the strongest oxidizing agent? a.) Zn(s) b.) Mg(s) c.) Al3+(aq) d.) Mg2+(aq)

    asked by Anonymous
  176. ENGLISH 9 hunger games

    How was recreation in the capital and the district different from each other full sentences please!!

    asked by Billo
  177. English

    1. If he be brave, he will try it again. 2. If he is brave, he will try it again. 3. If it rain tomorrow, I will not start. 4. If it rains tomorrow, I will not start. ------------- Are they all grammcatical?

    asked by rfvv
  178. Chemistry

    I need chemistry help. I think 1. c, 2.b, & 3.a (please tell me why or why not and help me set up the problems if possible) 1.) The following half reaction has been balanced except for the electrons. How many and where should the electrons be included? 14

    asked by Tyler
  179. CHEM

    1.) What is the correct net cell reaction for the electrochemical cell diagramed below? Ni(s) ∣ Ni2+(aq) || Ag+(aq) ∣ Ag(s) a.) Ag+(aq) + Ni(s) ---> Ag(s) + Ni2+(aq) b.) Ag(s) + Ni2+(aq) ---> Ag+(aq) + Ni(s) c.) 2Ag+(aq) + Ni(s) ---> 2 Ag(s) + Ni2+(aq)

    asked by Amber
  180. English

    1. If it rains tomorrow, I will not start. 2. If it should rain tomorrow, I will not start. 3. If it rained tomorrow, I would not start. 4. If it rained yesterday, he didn't go to work. ------------ Are they all grammatical? Which ones are not grammatical?

    asked by rfvv
  181. Physics

    A 1.75-kg wooden block rests on a table over a large hole as in the figure below. A 5.20-g bullet with an initial velocity vi is fired upward into the bottom of the block and remains in the block after the collision. The block and bullet rise to a maximum

    asked by Ana
  182. physics

    A 35kg lawnmower starts from rest. Its pushed with a force of 127N at an angle 40 degrees below horizontal. After 12s it reaches speed of 0.37m/s. Find acceleration and force of friction. Attempts: Well I figured out Fnormal=343 my multiplying mass by

    asked by jamie
  183. physics

    Atoms in a solid are not stationary, but vibrate about their equilibrium positions. Typically, the frequency of vibration is about f = 4.55 x 1012 Hz, and the amplitude is about 2.69 x 10-11 m. For a typical atom, what is its (a) maximum speed and (b)

    asked by Nick
  184. chemistry

    Sodium vapor lamps are used in Chicago to light city streets. The light emitted (given off) by these lamps has a λ of 5.9 x 10-7 m. What is the λ in cm? What is the λ in nanometers (nm) [1 meter = 1 x 109 nm]? What is the ν of this radiation? In what

    asked by mathew
  185. algebra

    Develop a tree diagram for tossing two, eight-sided gaming dice to figure out how many possibilities there are. Discuss the purpose of using such a visual in working out probability.

    asked by larry
  186. Physical Science

    Complete and balance the equation for the following single-replacement reactions. (Use the lowest possible coefficients. Omit states-of-matter from your answer.) Ni + Cu(NO3)2(aq)-->

    asked by Darrel
  187. english

    can you please continue this sentence.. "Love is like a cinema" i needed this to write a good theme for my project in literature..

    asked by Yeng
  188. Math

    Carl needs estimate the quotient 547 divideted by 92 explain how Carl could use compatible numbers to make a reasonable estimate

    asked by Estimate quotients
  189. physics

    A simple harmonic oscillator consists of a block of mass 1.20 kg attached to a spring of spring constant 190 N/m. When t = 1.80 s, the position and velocity of the block are x = 0.124 m and v = 3.190 m/s. (a) What is the amplitude of the oscillations? What

    asked by kelly
  190. physics

    The acceleration of gravity is 9.8 m/s 2 . What is the magnitude of the total force on a(n) 87 kg driver by the dragster he operates as it accelerates horizontally along a straight line from rest to 41 m/s in 5.3 s? Answer in units of kN

    asked by jo
  191. English (Reunion by John Cheever)

    In John Cheever's story reunion, what do the restaurants symbolize. Why does Charlie call hi father daddy at the end of the story? Examine the first and last sentences of the story. What is common and why? How do you interpret the ending of the story? Does

    asked by Aly
  192. Math PLEASE HELP ME

    A man has $210,000 invested in three properties. One earns 12%, one 10% and one 8%. His annual income from the properties is $20,100 and the amount invested at 8% is twice that invested at 12%. How much is invested in each property? at 12% 10% and 8% What

    asked by James
  193. Sixth Grade Math

    A car driving cross-country traveled 180 miles in 4 hours. At this rate of speed, how many miles further will the car travel in the next 3 hours? My answer is 135 miles. Is my answer correct?

    asked by Stephon
  194. science

    10. One group of gases that is responsible for destroying ozone in the ozone layer is A.car exhaust fumes B.CFCs C.nitrogen oxides and sulfur oxides D. Carbon monoxide and carbon dioxide I got B for my answer.

    asked by Sam
  195. Calculus

    Find dy/dx if x^2+y^2=2xy A. x/(x-y) B. (y+x)/(y-x) C. 1 D. -x/y E. None of these

    asked by Anon
  196. check my science hw please.

    18. Which of the following would be a cost of drilling for oil in Antarctica? A. The supply of heating fuel would be increased. B.There would be a greater opportunity to study wildlife there. C. An oil spill could harm food sources for penguins. D. Many

    asked by Sam
  197. check my science hw please.

    24. can provide an economic benefit to A. drug companies B. tourists C.hikers D.endangered species I got A for my answer.

    asked by Sam
  198. art

    why would an artist chose to use harmony in a piece of artwork?

    asked by elizabeth
  199. check my science hw please.

    25. All of the following factors affect an area's biodiversity EXCEPT A. areas B.number of endangered species C. climate D. diversity of niches. I got C for my answer.

    asked by Sam
  200. algerbra

    logarithmic form of: 4y=64

    asked by darlene
  201. check my science hw please.

    26. In the last few centuries, the number of species becoming extinct on Earth has A.decreased dramatically B. decreased slightly. C. increased slightly. D.increased dramatically I think it should be C.

    asked by Sam
  202. check my science hw please.

    30. Laws can help endangered species by prohibiting A. Captive breeding B.habitat preservation C diversity of genes D. products made from the species I got D, I have a feeling that this may be wrong.

    asked by Sam
  203. Calculus

    Find the limit as x approaches 1 5/(x-1)^2 I don't understand how to solve it because there would be a 0 on the denominator.

    asked by Anonymous
  204. Chemistry

    1. Suppose that you have 0.500 L of each of the following solutions, and an unlimited supply of water. (Note: C9H7NHBr is a salt containing the ions C9H7NH+ and Br− and C9H7N is quinoline, an organic base with pKb = 6.24 at 298 K. If you like, you may

    asked by Mcmaster university
  205. check my science hw please.

    31. Which of the following is an example of a global environmental choice? A. a student deciding to ride a bicycle to school B. a family deciding to recycle their newspapers C. a town meeting about a new nature refuge. D. nations meeting to discuss the

    asked by Sam
  206. trig

    Two circles of radii 5 and 3 cm, respectively, intersect at two points. At either point of intersection, the tangent lines to the circles form a 60◦ angle, as in Figure 2.2.4 above. Find the distance between the centers of the circles

    asked by Anonymous
  207. Math

    In a math contest of 10 problems, 5 points was given for each correct answer and 2 points was deducted for each incorrect answer. If Nancy did all 10 problems ad scored 29 points, how many correct answers did she have?

    asked by M
  208. chemistry

    chemical reactions type?

    asked by jose
  209. Physics

    The surface area of an adult human is about 1.8m2 . Suppose a person with a skin temperature of 34 ∘C is standing nude in a room where the air is 25∘C but the walls are 17 ∘C. A) There is a "dead-air" layer next to your skin that acts as insulation.

    asked by Drew
  210. Math

    1. If 100 is saved on October 1, 150 on October 2, 200 on October 3, and so on, how much is saved during October? 2. A Ping-Pong ball is dropped from a height of 16 ft and always rebounds 1/4 of the distance of the previous fall. a. What distance does it

    asked by Hershey
  211. chem 200

    669 cal of heat is added to 5.00 g ice at –20.0 °C. What is the final temperature of the water?

    asked by k
  212. Differential equations in Calculus...plsssss help?

    Suppose that represents the temperature of a cup of coffee set out in a room, where T is expressed in degrees Fahrenheit and t in minutes. A physical principle known as Newton’s Law of Cooling tells us that dT/dt = -1/15T+5 15T + 5. a) Supposes that T(0)

    asked by Bridget
  213. calculus

    The number of U.S. citizens 65 and older from 1990 through 2050 is estimated to be growing at the rate of, R(t)=0.063t^2 -0.48t+3.87, (0 less than or = t less than or = 15) million people/decade, where t is measured in decades and t = 0 corresponds to

    asked by mar
  214. chemical equations

    How do I write the chemical equation for Copper(II)nitrate + sodium hydroxide -> Copper(II)hydroxide + sodium nitrate? CuNO3 + NaOH-> CuOH + Na(NO3) is that right? Copper(II)hydroxide -> Copper(II)oxide + water CuOH -> CuO + H2O?

    asked by Anonymous
  215. Physics

    You may have observed that a car with windows closed sitting under the sun on a hot day, can get extremely hot in the interior, even hotter than the outside air. Explain this in terms of heat and temperature concepts. How is this similar to greenhouse

    asked by Hershey