Questions Asked on
September 24, 2013

  1. physics

    A package is dropped at time t=0 from a helicopter S that is descending steadily at a speed vi. (a) What is the speed of the package in terms of vi, g, and t? (b) What vertical distance d is it from the helicopter in terms of g and t? (c) What are the

    asked by Hamad
  2. Science

    A metal object with a mass of 19g is heated to 96 degrees celcius, then transfered to a calorimeter containing 75 g of water at 18 degrees celcius. The water and metal object reach a final temperature of 22 degrees celcius. What is the specific heat of

    asked by Ashleigh
  3. Mathematics

    Anna burned 15 calories per minute running for x minutes and 10 calories per minute hiking for y minutes. She spent a total of 60 minutes running and hiking and burned 700 calories. The system of equations shown below can be used to determine how much time

    asked by Joy
  4. math

    A stunt motorcyclist makes a jump from one ramp 20 feet off the ground. The jump between ramps can be modeled by y= -1/640x^2 + 1/4x +20 where x is the horizontal distance (in feet) and y is the height above ground (in feet). I think a is 20 feet, but I

    asked by Joel
  5. physics

    A 65-kg bungee jumper has fallen far enough that her bungee cord is beginning to stretch and resist her downward motion. Find the force (magnitude and direction) exerted on her by the bungee cord at an instant when her downward acceleration has a magnitude

    asked by Victoria
  6. math

    find the measure of each interior angle of a regular 18 - gon.

    asked by ssss
  7. Math

    Find the difference: 3-(-9) A. -12 B. -6 C. 6 D. 12 I got the answer on (D)12 but I am not 100% sure becuase they ask the difference, not the sum.

    asked by Savannah
  8. Education

    Which of the following would be most commonly accepted by most intelligence experts as an indication of intelligence A) being able to play Gershwin's "Rhapsody in Blue" after a relatively short period of practice B) solving problems such as, "If all A are

    asked by Lor
  9. Algebra

    Mona earns 3 times as much as an actuary as she does as a writer. Her total income is $40,000 more than her brother. He earns half as much as Mona does as an actuary. What is Mona's salary as an actuary?

    asked by Stephanie
  10. Calculus

    How do I find the critical values? y= 4/x + tan(πx/8) What I did is I simplified it to y= 4x^-1 + tan(πx/8) then I took the derivative y'= -4x^-2 + (π/8)(sec(πx/8))^2 Then I simplied it y'= -4/x^2 + (π/8)(sec(πx/8))^2 then I found a common denomiator

    asked by John
  11. statistics

    A set of final exam scores in an organic chemistry course was found to be normally distributed, with a mean of 73 and a standard deviation of 8. What is the probability of getting a score higher than 71 on this exam?

    asked by Selene
  12. Chemistry

    2 NaN3(s) = 2 Na(l) + 3 N2(g) How many grams of NaN3 are needed to produce 20L of N2(g) at 303K and 776mmHg?

    asked by Nancy
  13. chemistry

    write the balanced equation for the reactions of aquesous pb(CIO3)2 with aqueous Nal. include phases. 2.If a solution containing 86.044 g of mercury(II) chlorate is allowed to react completely cointaing 15.4888 g of sodium sulfide, how many grams of solid

    asked by christina
  14. chemistry

    A rectangular sheet of lead shielding is placed over the chest of a patient in a dental office while X rays are taken. The sheet measures 65.0 cm by 55.0 cm by 0.30 cm. If the density of lead is 11.3 g/cm3, what is the mass of lead apron?

    asked by Sonya Reid
  15. Physics (URGENT)

    Three wire-wound resistors have the following values: 30 ohms, 80 ohms, and 100 ohms. Each resistor has a voltage rating of 100V. If these three resistors are connected in series, can they be connected to a 240V circuit without damage to the resistors?

    asked by Anonymous
  16. Chemistry

    Microwave ovens emit microwave energy with a wavelength of 12.5 cm. What is the energy of exactly one photon of this microwave radiation?

    asked by Kiana
  17. Math Word Problem

    The Mesozoic Era began about 250,000,000 years ago. The Palezoic Era began 292,000,000 years before that. How long ago did the Palezoic Era Begin? A. 42,000,000 Years B. 492,000,000 Years C. 542,000,000 Years D. 556,000,000 Years

    asked by Jared
  18. Math

    Joan made 1 1/2 gallons of punch. She used 2 pints of lemonade and 3 quarts of ginger ale. The rest of the punch was orange juice. How many quarts of orange juice did Joan use?

    asked by T. W.
  19. expression help

    which is the sum or difference is equivalent to the following expression 3x-2/9 *fraction*

    asked by Alex
  20. language

    which of the following describes feedback in an oven ? a) setting the temperature b) burning gas releases heat c) a thermostat monikers the temperature and increase the gas flow when the temperature falls too low d) a cake is baked

    asked by victoria
  21. Grammar

    If as writing Spanish Conquistadors, would it have to be capitalized? how about European Explorers?

    asked by Unknown
  22. History

    What are 5 major impacts of the Greek Civilization and evaluate the influence on US culture even today?

    asked by Beatriz
  23. Math

    Find two numbers the exact answer is between 6x7,381

    asked by Caleb
  24. math

    9 + 7 x (15 + 3) divided by 9

    asked by Zion
  25. Geography (Ms. Sue)

    1). How might democratic reforms and improved trade agreements contribute to a stronger economy in Mexico? 2). What effect might Mexico's young population have on its development? 3). In what ways have Native American and Spanish influences shaped Mexico?

    asked by Anonymous
  26. Property help

    what property is this? (3z)xy=3(zx)y is it a communative property of addition? if not what is it? thank you

    asked by Alex
  27. Algebra 2

    For the period 1990-2002, the number s (in thousands)lf cellular telephone subscribers in the United States can be modified by S=858t^2 + 1412t + 4982 where t is the number of years since 1990. In what year did the number of subscribers reach 50 million?

    asked by Krystal
  28. math

    It's recommended that a person drink six 8-ounce glasses of water a day. Which expression shows how many ounces of water a person should drink over a 5-day period?

    asked by jay
  29. Algebra

    Leo's garden, which is 6m wide, has the same area as Jen's garden, whichis 8m wide. Find the length of the two rectangular gardens if Leo's garden is 3m longer than Jen's garden.

    asked by Stephanie
  30. Geometry

    2,3,5,7,11... What is the inductive reasoning?

    asked by Krista
  31. chemistry

    A 6.25 gram sample of copper(II) chloride hydrate was heated until all the water was liberated. The residue massed 4.45 grams. How many water molecules are present for every formula unit of copper(II) chloride?

    asked by Peytreshia
  32. Math Algebra

    Question:: You are about to take a test that contains questions of type A worth 4 point and of type B worth 7 points. You must andwer at least 5 of type A and 3 of type B, but time restricts answering more than 10 of either type. Intotal, you can answer no

    asked by Dulcina
  33. calculous

    An airplane flies at an altitude of 2 miles toward a point directly over an observer (see figure). The speed of the plane is 600 miles per hour. Find the rates at which the angle of elevation θ is changing when the angle is θ = 30°, θ = 60°, and θ =

    asked by Anonymous
  34. Expression Help

    simplify the following expression 1/4 *fraction* (24-16x) Answers 6+4x 6+4 6-4x 6-4 Is it A?

    asked by Alex
  35. Economics

    Please help explain A manufacturer of motorcycle batteries has a plant capacity of 100,000 per year. Overhead costs are $500,000 per year. Variable costs are $10 per unit. Sales have been running at 50,000 per year at a wholesale price of $25 each.

    asked by Fort
  36. biology

    The sequence below begins with the initiator methione. ATGTTCAATGTTATGGATTGGCCCTGGTAAATGAAATAGAATGAT Please give a hypothetical (translation of cDNA sequence into single amino acid codes if there is a C deletion in the phenylalanine codon _4pts.(Please

    asked by aisha
  37. Accounting

    You received an email from Carl the operations manager from the California Container division. They produce packaging for cell phones. Carl understands that his product is an important cash producer for the company. •The delivery price is based on long

    asked by Tracy
  38. science of speed and acceleration

    You are traveling at a speed of 42 miles in .75 hours and slow to a speed of 42 miles in 1.25 hours. What is your rate of deceleration?

    asked by Robert
  39. 12th grade chemistry

    What is the structure for ethyl ethanamide? (Ie. c-c-N-c-c) ??? Thanks

    asked by Michaela
  40. Math

    Sue and Joe both ordered a small pizza each. Sue ate 2.5 slices of her pizza and Joe ate 3/4 slices of his pizza. What fraction more of pizza did Joe eat?

    asked by Anonymous
  41. chemisry

    What are the specializations of sanitary engineering? Drinking water supply Sewage Wastewater treatment 2) Name the different parts of the drinking water supply system? Production Storage Distribution 3) Which of the following three systems can be

    asked by Anonymous
  42. Algebra

    Factor completely. (a^2+2ab+b^2-c^2)

    asked by Anonymous
  43. physics

    The Vector A is 3cm long and points to the right. The vector B is 6cm long and makes an angle of 130 degrees with the horizontal (take 0 degrees to be to the right). The vector C= A+B. What is the lenght and direction of C?

    asked by Gabrielle
  44. Expression

    (4/7)^3 *fraction* I have never done this kind of expression before. Answer 343/64 21,952 407 64/343 Is it A?

    asked by Alex
  45. math

    I am trying to figure out the surface area of a garage. It has an A shaped roof. There is an overhang of 0.5m on each corner. Do I include this in determining the area of the roof? I need to figure out how much stucco is needed for the garage minus roof,

    asked by Cherie
  46. Chemistry

    which is more accurate direct weighting or weighing by difference?

    asked by Justin
  47. math

    mr.kirby has 246 stickers.ms.hayes has fewer stickers.which number tells how many stickers ms.hayes could have?

    asked by abrar
  48. English 1

    In the story A Christmas Memory. 1. In at least one paragraph, describe what you think the message is the author is trying to convey in the story. What specific details from the story make you believe this? 2. In at least a few sentences, describe how this

    asked by Dana
  49. troy

    A car is parked on a cliff overlooking the ocean on an incline that makes an angle of 15.0° below the horizontal. The negligent driver leaves the car in neutral, and the emergency brakes are defective. The car rolls from rest down the incline with a

    asked by d
  50. Chemistry

    Convert 1.46 mm to inches.

    asked by Joli
  51. Economics

    What prediction is shared by the neutrality of money and the natural rate hypothesis (NRH)?

    asked by Joy
  52. Phyics

    In an historical movie, two knights on horseback start from rest 94.3 m apart and ride directly toward each other to do battle. Sir George's acceleration has a magnitude of 0.273 m/s2, while Sir Alfred's has a magnitude of 0.280 m/s2. Relative to Sir

    asked by question
  53. math

    ms. Dixon sees more than 199 birds but fewer than 132 birds.how many birds might she have seen?

    asked by abrar
  54. phyics

    A car is traveling at a constant speed of 31.8 m/s on a highway. At the instant this car passes an entrance ramp, a second car enters the highway from the ramp. The second car starts from rest and has a constant acceleration. What acceleration must it

    asked by larry
  55. Citizenship- Bosnian War

    I need to write a for and against argument on the following: FOR arguments that Milosevic should go to war & AGAINST arguments that Milosevic not be bought to the ICC Background Info: Milosevic was the president of Serbia and sided with them to go against

    asked by HS
  56. math

    Order of operation (2×3+7^2)-10

    asked by Gio
  57. Physical Science

    A 20,000 kg railroad car is traveling at 3 m/s when it collides and couples with a second, identical car at rest. What is the resulting speed of the combined cars?

    asked by Jenna V
  58. Geography

    What is the name given to the vast rural area in the center of the Australian continent? What natural features explain the very sparse population of this area? Please help i'm very confused and all the websites have different info.

    asked by Saru
  59. Sociology

    can someone please tell me what are the causes of alienation? I cant find the answer in many sociology books !!Please help!

    asked by Pallavi
  60. Algebra 2

    Write this expression in expanded form. 4(a-b)2

    asked by Margie
  61. spanish

    Can someone check this.. I put a * by my answers. juan se lava el pelo con la pasta de dientes true * false

    asked by ilikespanish
  62. Math - Functions

    The research department in a company that manufactures AM/FM clock radios established the following cost, and revenue functions: R(x) = x(50-1.25x) C(x) = 160 + 10x where 0 < x < 20. a) Determine when R = C (to the nearest thousand units. e.g. 6.247)

    asked by Ally
  63. Hello Jiskha

    I must say, you have been one of the most helpful sites that I have been on. You don't lie to people about the answers. You help the people understand, So I would just like to show my gratitude. Thank you so much for your help, with out you guys, Open

    asked by This Girl
  64. Algebra 2

    (12xy)4

    asked by Margie
  65. Education

    What is the prevalence of diagnosed learning disabilities across the U.S.? A) 1-3% of students B) 3-9% of students C) 10-15% of students D) 15-20% of students I think the answer is C, is this right?

    asked by Lor
  66. Math

    Use symbols to represent unknowns and variables. Write inequalities to answer questions arising from situations. 1. Ten less than a number, x, is greater than 32. 2. A number, n, decreased by 6 is less than or equal to 4. 3. One half of a number, increased

    asked by Pam
  67. physics

    A car accelerates uniformly from 10m/s to 24m/s.Ehat is its average speed?

    asked by cleverdoc2
  68. Math

    Pls check (3×8+4^2)-9 24+16 40-9 31 6×(10+6)-6^2 6×16 96-6^2 96-36 60

    asked by Gio
  69. Accounting

    Why is the cash basis of accounting not used when preparing financial statements?

    asked by Anonymous
  70. math

    Jamie Thompson is thinking about investing in some residential income-producing property that she can purchase for $200,000. Jamie can either pay cash for the full amount of the property or put up $50,000 of her own money and borrow the remaining $150,000

    asked by zeenat
  71. English

    Anyone read my story and tell me any of the linking verbs? I cant have more than 2. And also any other grammar mistakes? Thanks. I already looked over it I just need more help. Three years ago I took drum lessons at an academy. I had taken lessons there

    asked by Anonymous
  72. Music

    Is playing a dotted quarter note, one eighth note tied with a quarter note, and then an eighth note the same as : a dotted quarter note, one eighth note, an eighth rest, one eighth note, and then a quarter note?

    asked by Anonymous
  73. math

    A fair six sided dice has the faces numbered from 1 to 6. The dice is thrown 4 time. Calculate the probability of exactly 2 fives. the answer is 25/216

    asked by kirsten
  74. Algebra 2

    | t - 7 | + 3 > or = 4

    asked by Tim
  75. math

    •A customer is buying a $100 drill and two $15 drill bit sets. The customer uses a gift card worth $50 to pay for a portion of their bill. How much cash will the customer pay (before taxes)?

    asked by Anonymous
  76. math

    In the game of roulette a ball rolls into one of 37 slots. All the slots are evenly likely. Eighteen of the slots are red, eighteen are white and 1 is green. the ball is rolled 10 times. Calculate the probability of exactly 6 reds? the answer is 0.l94

    asked by kirsten
  77. news. significance and impact

    Chrysler Group LLC filed for an initial public offering. This move was forced by failure of the auto maker’s Italian majority owner and its main union to agree on the company’s value. Fiat SpA owns 58.5 percent of Chrysler, they don’t want a share

    asked by Blaze
  78. Math

    mr blackwell tracks sales of ski equipment each week for a month. complete the table to determine which week had the highest percent of ski equipment sales.

    asked by Tiffany
  79. physics

    write an derival quantity,formulae and unit

    asked by write an derival quantity,formulae and unit
  80. Principles of Accounting

    I need help understanding my Accounting 205 class. Would some one please help me understand what I am having such a hard time comprehending.

    asked by Anonymous
  81. Phyics

    A sprinter explodes out of the starting block with an acceleration of + 2.43 m/s2, which she sustains for 1.10 s. Then, her acceleration drops to zero for the rest of the race. What is her velocity at (a)t = 1.10 s and (b) at the end of the race?

    asked by Corey
  82. more News

    Senate Democrats are discussing a shorter-term measure to keep the government funded after the end of this month. They hope to move quickly to a more permanent spending program and move past the controversial fights that have tied up both chambers of

    asked by Blaze
  83. chemistry

    A rectangular sheet of lead shielding is placed over the chest of a patient in a dental office while X rays are taken. The sheet measures 65.0 cm by 55.0 cm by 0.30 cm. If the density of lead is 11.3 g/cm3, what is the mass of lead apron?

    asked by Sonya Reid
  84. chemistry

    A rectangular sheet of lead shielding is placed over the chest of a patient in a dental office while X rays are taken. The sheet measures 65.0 cm by 55.0 cm by 0.30 cm. If the density of lead is 11.3 g/cm3, what is the mass of lead apron?

    asked by Sonya Reid
  85. Answers check and help!

    d. Calculate the mean square for 1) gender, 2) marital status, 3) interaction between gender and marital status, and 4) error or within variance. e. Calculate the F ratio for 1) gender, 2) marital status, and 3) interaction between gender and marital

    asked by Vanessa
  86. math

    The sum of two decimal numbers is 3.9 Their difference is 0.9,and their product is 3.6 What are the two numbers?

    asked by Joel
  87. Geography (Ms. Sue)

    4). What European countries had colonies in the Caribbean? 5). Which European country settled most of Central America? My answers to these questions are the following: 4). Spain, France, Great Britain, Netherlands, Denmark had colonies in the Caribbean.

    asked by Anonymous
  88. books(short essay)

    Describe the sentence structure Stephen Lautens uses in "A Thankless Experience". Support your view with examples from the essay. This is the story: A Thankless experience by Stephen Lautens this story is on the internet I was about to post the url but

    asked by Andy
  89. Geometry

    Explain why sinx degrees= cos(90-x)degrees. include a diagram with your explanation.

    asked by George
  90. Geometry

    A regular pentagon with radius 5inches.

    asked by George
  91. books (A thankless experience)

    Explain whether Lautens' essay is written formally or informally, referring to examples from the essay for support. The short essay is on the internet called A thankless experience by Stephen Lautens. I can not post the url because jiskha does not allow

    asked by Andy
  92. Physics

    A gun is fired and a 56g bullet is accelerated to a muzzle speed of 130m/s . Part A If the length of the gun barrel is 0.60m , what is the magnitude of the accelerating force? (Assume the acceleration to be constant.)

    asked by Joe
  93. Geometry

    A regular hexagon with radius 6.2m.

    asked by George
  94. Geometry

    A plane flying 16 degrees west of north at 289mph is flying in air which is moving 32mph at due west. Find the resulting speed and direction of the plane. (Step by step please!)

    asked by George
  95. language

    1.which factor is most helpful in helping technology to progress? a) unintended consequences b) a better understanding of the natural world c) risk-benefit analysis d)obsolete technologies 2. an oven is a technological system. which of the following

    asked by victoria
  96. IWU

    You are considering buying 27 silver coins that look alike, but you have been told that one of the coins is a lightweight counterfeit. Find the least number of weighings on a balance scale that you can use to be certain you have found the counterfeit coin.

    asked by JC
  97. Geometry

    what is the volume of a cylinder with a radius of 1.2 and height of 5.3cm

    asked by George
  98. Geometry

    what shape does a square form when rotated?

    asked by George
  99. physics

    How much heat ( In calories)is needed to warm 200 grams of water from an initial temperature of 24 degrees celsits to a final temperature of 84 degrees celsuis

    asked by teresa
  100. Geometry

    what shape does a semi circle form when rotated?

    asked by George
  101. Biology of Environment

    Complex systems have multiple sub systems, what would be example of this? A tree?

    asked by Mohammad
  102. english

    what are your political, economic and autonomy goals?!

    asked by alyssa
  103. Geometry

    find the volume of a triangular prisim with a=2.3, c=2 and h=1.5

    asked by George
  104. social studies

    which Iroquois nations lived the farthest from New York City?

    asked by ezekiel
  105. AP physics

    A car is traveling at 60.0 mph when it collides with a stone wall. The car comes to rest after the first foot of the car is crushed. What was the average horizontal force acting on a 150-lb driver while the car came to rest? If five cardboard boxes, each 4

    asked by leia
  106. Biochem

    You have prepared a 400 mL of a .210 M acetate buffer solution with a pH of 4.44. 1. Determine the concentration of both the acetate and acetic acid in the solution. 2. If you made this solution using solid sodium acetate (MW = 136 g/mol) and liquid acetic

    asked by Ross
  107. Math: is it? is it not?

    Is this math problem hard? - There are 12 brothers living in a mansion. Six brothers are sitting in a rectangular kind of table. Six other brothers stood around them. They all have ten huge backpacks. Each backpack has 8 large monkeys. For every large

    asked by Losa
  108. math

    (3+7)x 6+4

    asked by Zion
  109. Calculus

    6/ln[x] find the derivative... im coming up with -6/x*(ln(x))^2 but it isn't accepting the answer what am i doing wrong?

    asked by Tim
  110. Gardner High School

    evaluate the expression /-8/ /4/ /-2.3/ /1.8/

    asked by Syndi MEnotr
  111. American U.S.History

    1.What did the Townshend Duties do? 2.What was the principle of virtual representation?

    asked by yulonda
  112. Math

    In a basketball game Maria scored 3 times as many points as Holly. In the next game, Maria scored 7 fewer points than she did in the first game, while Holly scored 9 more points than she did in the first game. If they scored the same number of points in

    asked by Stephanie
  113. Calculus

    g(x)= {0 if x2 Find all values x=a where the function is discontinuous. Is the answer 0 and 2 or just 2?

    asked by tony
  114. American U.S.History

    1.Which statement is not true concerning the Albany Plan of Union? 2.How did Americans oppose the Stamp Act? 3.What was the purpose of the 1764 Sugar Act?

    asked by yulonda
  115. Social Studies

    This is a debate about the age of young offenders.I am saying that the age for young offenders should be 10 to 18, Iinstead of 12 to 17. Can someone give me some ideas?

    asked by Jake Greenwood
  116. Lang ARts

    I to choose between the word indictment and verdict for the sentence below. I was given a sheet with the definition for both but neither seems to fit. The __________ revealed that the man was guilty and should go to jail for three years.

    asked by Brandi
  117. Math

    You withdraw $260 from your bank account in 5 trips to the ATM. What is the average change in your account balance after each trip? A submarine descends 60ft./min. What depth below the water's surface will the submarine reach in 4 min after leaving the

    asked by Stacy
  118. math

    2x-6/3=-2

    asked by j
  119. Physics

    An unstretched spring with spring constant 37 N/cm is suspended from the ceiling. A 3.3 kg mass is attached to the spring and let fall. To the nearest tenth of a centimeter, how far does it stretch the spring?

    asked by Jay
  120. Pre algebra

    A number multiplied by itself and then by itself again gives -1,000. What is the number? Please show the solution step by step

    asked by Jude
  121. Geometry

    3,4.5,6.75,10.125... what is the inductive reasoning?

    asked by Krista
  122. Math

    In a group of quarters and nickels, there are four more nickels than quarters. How many nickels and quarters are the if the coins are worth $2.30? Plsmshow the solution, thanks

    asked by Jude
  123. Algebra 2

    A stunt motorcyclist makes a jump from one ramp 20 feet off the ground. The jump between ramps can be modeled by y= -1/640x^2 + 1/4x +20 where x is the horizontal distance (in feet) and y is the height above ground (in feet). I think a is 20 feet, but I

    asked by Krystal
  124. Chemistry

    If 4.00 grams of the hydrate in #1 are heated how many grams of anhydrous salt would remain after all the water was liberated?

    asked by sTin
  125. Geometry

    2,3,5,7,11.... What is this inductive reasoning?

    asked by Krista
  126. Geography (Ms. Sue)

    What does Mexico City's site on top of the Aztec city suggest about the location?

    asked by Anonymous
  127. Math

    A certain bacteria doubles the number of its cells every 20 minutes. A scientist puts 50 Cells in a culture disk. How many cells will be in the culture disk in 2 hours?

    asked by Jude
  128. Geometry

    find the area of a regular pentagon with radius 5in

    asked by George
  129. Geometry

    2,3,5,7,11.... What is this inductive reasoning?

    asked by Krista
  130. chemistry

    In a chemical reaction, exactly 2 mol of substance A react to produce exactly 3 mol of substance B. How many molecules of substance B are produced when 26.5 g of substance A reacts? The molar mass of substance A is 21.9 g/mol. Step 1: Convert the mass of A

    asked by bb
  131. Geometry

    3,4.5,6.75,10.125... what is the inductive reasoning?

    asked by Krista
  132. Geometry

    find the area of a hexagon with radius 6.2m.

    asked by George
  133. physics

    A fish is rising vertically to surface of a lake at rate of 2 m/s observes a bird diving vertically towards water at 4 m/s. The refractive index of water is 4/3. what is actual velocity of bird

    asked by swati
  134. Math help

    How is writing an equation to represent a situation involving two variables similar to writing an equation to represent a situation involving only one variable? How is it different?

    asked by Charlotte
  135. Math

    There is a rectangle that is 42 ft. long containing 1,032 sq. yds. How much fencing material is needed to enclose it?

    asked by Kaye
  136. Chemistry

    Upon heating 8.5g sample of Sodium Sulfate hydrate, it loses 4.776 grams after heating. What steps are necessary for me to find the n for the hydrate? GIVEN: Na2SO4 - n H2O the molar mass of sodium sulfate is 142.05g/mol

    asked by Peytreshia
  137. math

    3/4(-2x+3)+7x/2=11/4

    asked by alicia
  138. math

    suppose that an employee ears $28,000 in the first year on the job. Each year thereafter, the employee receives a %3 raise. Find the total amount that the employee earned in all 20 years.

    asked by Natalie
  139. Expressions help

    I have no idea on how to do this equation please help me. What is the simplified form of the following expression 2x^2y+3x^2+4y+3x^2y+2y possible answers 1.)5x^4y^2+3x^2 2.)8x^2y+6y^2 3.)5x^2y+3x^2+6y 4.)14x^2y Is it 3?

    asked by Alex
  140. fractions

    a recipe calls for 1/4 teaspoon of salt. to make three times the amount how much salt is needed?

    asked by b
  141. grammar

    underline simple subject and simple predicate: Ireland's highest peak is in the Mountains of Kerry. simple subject is peak simple predicate is "is in"

    asked by cici
  142. Geometry

    Three coplanar lines always make a triangle? Find a counter example.

    asked by Krista
  143. algebra 1

    Tell whether the sequence is arithmetic. If the sequence is arithmetic, write a function rule to represent it. 12, –9, 6, –3, ...

    asked by bobby
  144. chem

    At noon on a clear day, sunlight reaches the earth\'s surface at Madison, Wisconsin, with an average power of approximately 4.00 kJ·s–1·m–2. If the sunlight consists of photons with an average wavelength of 510.0 nm, how many photons strike a 5.10

    asked by Anonymous
  145. math

    a water tower that is 11 ft. high and the diameter 18 ft. how many cubic feet are in this tower?

    asked by debbie
  146. math 7 accelerated

    Yanira is 3 years older than Tim and twice as old as Hannah. Tim is 2 years older than Hannah. How old are Yanira Tim and Hannah? Explain how you did the problem and the answer.

    asked by tom
  147. Chemistry

    There are two flask, one filled with a)ice bath, and b)boiling water. Ice bath: 1.00 L O^2(g) at STP Boiling water: 1.00 O^2(g) If we want the pressure to remain at 1.00bar when the O^2(g) is heated to 373K, what mass of O^2 must we release from the flask?

    asked by Mae
  148. reading

    How do I read and not lose focus on what I am reading? Like how do I comprehend what I am reading?

    asked by Johnny
  149. physics

    If two wires P and O each of the same length and same material,are connected in parallel to a battery. The diameter of P is half that of Q. What fraction of the total current passes through P?(a)0.2(b)0.25(c)0.33(d)0.5

    asked by Roy
  150. Math

    1. 0.17x8= 1.36 2. 7.56x3=22.68 3. 6.08x0.9= 5.472 4. 2.34x0.7= 1.638 5. 3.74x0.002= 0.0748 6. 8.45x0.35-2.9575 7. 11.59x4.06=47.0554 8. 0.0429x0.78= 0.033462

    asked by Jerald
  151. Math

    My nephew is in the 4th grade and asked me to help him answer this question: Two 6 digit numbers have three 8's and three 7's. no two digits are the same. write the numbers in standard form. and i am not sure how to solve it.

    asked by Angelica Almanza
  152. Physics; help please :)

    A car A moves to the left with speed 40 km/h(with respect to the road). Another car (B) moves to the right with speed 60 km/h (also with respect to the road). Find the relative velocity of B with respect to A.

    asked by Celine
  153. math

    Your store’s average basket (transaction) size for the month of March was $11.50 and you believe the average basket size will remain the same for your store in April. One of your hourly employees had an average basket size of $9.00 for the month of March

    asked by Anonymous
  154. grammar

    George Bernard Shaw was popular in English and American theaters. Simple Subject is George Bernard Shaw Simple Predicate is "was"

    asked by cici
  155. statistics

    A popular retail store knows that the purchase amounts by its customers is a random variable that follows a normal distribution with a mean of $30 and a standard deviation of $9. What is the probability that a randomly selected customer will spend between

    asked by Selene
  156. 5th grade math

    I need to use quarters, dimes, nickles and pennies to make the following: $1.53 in 12 coins $2.53 in 20 $2.32 in 15 coins $2.00 in 22 $1.45 in 10 coins $1.76 in 16 coins $0.85 in 11 coins $1.01 in 12 coins $1.29 in 15 coins

    asked by Kyle
  157. Physics

    An object is launched horizontally with a velocity of 12 m/s. What is the vertical component of velocity after 2s? What are the coordinates of the object after 4s?

    asked by Celine
  158. math

    suppose 1 milliliter of ink can print 30 pages of text how many pages of text with 2 quarts of ink

    asked by Aaron
  159. English

    Please track the errors by editing this passage of writing. This is an exercise for my English homework. I have made a couple of changes or editing to the writing piece already, but I am not sure if there are more editing that needs to be made. Also,

    asked by Sara
  160. math

    suppose 1 milliliter of ink can print 30 pages of text how many pages of text with 2 quarts of ink

    asked by Aaron
  161. calculous

    An airplane flies at an altitude of 2 miles toward a point directly over an observer (see figure). The speed of the plane is 600 miles per hour. Find the rates at which the angle of elevation θ is changing when the angle is θ = 30°, θ = 60°, and θ =

    asked by Anonymous
  162. math

    I im learningabout fractions is there an faster or easier way i can do them?

    asked by leanna
  163. jm

    What are examples of being physically active

    asked by Anonymous
  164. Art

    I'm in art and i cant draw a bear do you have any tips?

    asked by leanna
  165. Algebra

    Graph inequalities -2x>18

    asked by Casey
  166. Child day care management

    A2006 survey stated that youngsters ages 12-17 who were left home three or more days

    asked by Hana
  167. Calculus

    f(x)= ⎨x^2-1 / x+1, for x not = -1 ⎨8, for x=-1 I'm trying to graph and determine the values of x for which the function is continuous. Does the graph looks like a u shape opening up or a line.

    asked by tony
  168. English

    Please track the errors by editing this passage of writing. This is an exercise for my English homework. I have made a couple of changes or editing to the writing piece already, but I am not sure if there are more editing that needs to be made. Also,

    asked by Sara
  169. math

    suppose 1 milliliter of ink can print 30 pages of text how many pages of text with 2 quarts of ink

    asked by Aaron
  170. biology

    4pts((all(or(none): Q1:(Draw(a(gene(with(three(exons(on(the(line(below. The(coding(region((ORF) is(completely(contained(in(the(second(exon. Make(sure(you(annotate(the(following(regions: TSS 5’UTR(all(regions) Coding(sequence 3’UTR(all(regions)

    asked by aisha
  171. physics

    what are imp. l/q of unit 6 (work and energy)

    asked by hamza
  172. Poetry

    2) What is the rhyme scheme of the following poem? He sat upon his brand new bike Waiting for his best friend Mike He couldn’t wait to ride to school Others would say his bike is cool (1point) A a b b A b a b a b c d*** A a b a Better?

    asked by Gabby
  173. physics

    The eye of a hurricane passes over Grand Bahama Island. It is moving in a direction θ = 50° north of west with speed v1 = 34.5 km/h. Exactly three hours later, the course of the hurricane shifts due north, and its speed slows to v2 = 16.1 km/h, as shown

    asked by Anonymous
  174. physic

    ferryboat traveling at a speed of 30 km/h attempts to cross a river with a current of 5 km/h. What is the boat's speed relative to the shore?

    asked by ty
  175. English

    Just then my Uncle Sol offered Grandma a compliment. "Esther," he said, "that's a beautiful football. Real cott gless." Grandma looked at Uncle Sol with great superiority. "Sol," she said, "listen close, you'll learn something. This cott gless is called a

    asked by Anonymous
  176. physics

    A ball starts at the origin from rest rolling down a hill. It takes seven seconds for the ball to reach point “A”, which is 25 meters from the origin. At point “B”, the ball’s velocity is 15 m/s. You may assume constant acceleration. a. What is

    asked by Sue
  177. physics

    A superhero flies 310 m from the top of a tall building at an angle of 15 ◦ below the horizontal. What is the horizontal component of the superhero’s displacement? Draw the vectors to scale on a graph to determine the answer. Answer in units of m Your

    asked by Brandom
  178. Math!!!

    What is the sign of each product? Explain. 32. n • n, where n is any nonzero number 33. y • y • y, where y is any negative number 41. Scientists drill 40,230 ft. Into Earth's crust. Write an integer to represent this depth. Estimate the depth drilled

    asked by Tamara
  179. math

    Yanira is 3 years older than Tim and twice as old as Hannah. Tim is 2 years older than Hannah. How old are Yanira Tim and Hannah? Explain how you did the problem and the answer. math 7 accelerated - tom, Tuesday, September 24, 2013 at 6:46pm Ms. Sue thanks

    asked by tom
  180. English

    Identify the prepositional phrase in the following sentences from the passage. Uncle Sol was impressed. "Very smot," he said. "Very nice. But, Esther, now tell me something. How come you got a football in your frutt bol?" a. got a football b. in your frutt

    asked by Anonymous
  181. Algebra II

    Given the function k(x) = x2, compare and contrast how the application of a constant, c, affects the graph. The application of the constant must be discussed in the following manners: k(x + c) k(x) + c k(cx) c • k(x)

    asked by Nicole
  182. SS

    How is province related to America?

    asked by Unknown
  183. Calculus

    f(x)= |x−8| / x+8 Is the function is not continuous at x= -8,8 or just at -8.

    asked by tony
  184. math

    Sam emptied his coin bank and made a bar graph of the numbers of each type of coin the interval he was 5 coins If graph showed 5 intervals of quarters, 2 intervals of dimes,3 intervals if nickels and 10 intervals of pennies what was total amt of money in

    asked by Daniel mom
  185. science

    You are traveling at a speed of 42 miles in .75 hr and slow to a speed of 42 miles in 1.25 hr. What is your rate of declaration?

    asked by Robert
  186. physics

    A spinning top, having an initial angular velocity ω = 3.3 rad/s is given the angular acceleration profile shown in the graph. What is the top's angular velocity at time t = 6 s

    asked by Sue
  187. ICT

    Hi I'm stuck on my word processing crossword: -(5 letters) "The size of the font used" Thankkkss.

    asked by Julliette
  188. Phsyics

    A model rocket is launched at an angle of 80 degrees aboce the x axis, with a velocity of 30m/s. How high will the rocket be 5 seconds after launch? ROund your answer to the nearest tenth

    asked by Derrick
  189. PHYSICS

    Two protons in a molecule are 3.80 multiplied by 10-10 m apart. Find the electrical force exerted by one proton on the other. Magnitude N (b) State how the magnitude of this force compares with the magnitude of the gravitational force exerted by one proton

    asked by suhani
  190. math

    Which statement is true? A.The sum of two positive integers is sometimes positive, sometimes negative. B.The sum of two negative integers is always negative. C.The sum of a positive integer and a negative integer is always positive. D.The sum of a positive

    asked by Savannah
  191. PHYSICS

    A rod 14.0 cm long is uniformly charged and has a total charge of -20.0 µC. Determine the magnitude and direction of the electric field along the axis of the rod at a point 36.0 cm from its center. N/C

    asked by suhani
  192. Math

    Write remainder as a fraction in simplest form: 567/15=

    asked by Nick
  193. algebra homework

    f(x) and g(x) are monic quadratic polynomials that satisfy the following conditions: f(x)=0 has real distinct roots a1 and a2. g(x)=0 has real distinct roots b1 and b2. {f(b1),f(b2)}={b1,b2}. (set of f(b1),f(b2) is same as b1, b2) {g(a1),g(a2)}={a1,a2}.

    asked by nanoguai
  194. math

    Sue and Joe each ordered a small pizza. Sue ate 2.5 of her pizza. Joe ate 3/4 of his pizza. What fraction of a pizza did Joe eat more than Sue?

    asked by Anonymous
  195. 8th Grade Math

    25/50 x 60/70 x 100/200= 72 6/7

    asked by Nick