Questions Asked on
June 8, 2013

  1. Accounting

    What is the total stockholders' equity based on the following account balances? Common Stock $450,000 Paid-In Capital in Excess of Par 90,000 Retained Earnings 190,000 Treasury Stock 10,000 Answer A.$740,000 B.$730,000 C.$720,000 D.$640,000

    asked by TS
  2. physics

    an electron with a speed of 5.00 x 10^8 cm/s enters an electric field of magnitude 1.00 x 10^3 N/C, traveling along field lines in the direction that retards its motion. a) How far will the electron travel in the field before stopping momentarily b) how

    asked by Anonymous
  3. math

    identify the variable, population and is this quantitative or qualitative The archaeological site of Tara is more than 4000 years old. Tradition states that Tara was the seat of the high kings of Ireland. Because of it's archaeological importance, Tara has

    asked by marie
  4. math

    6. -2r(8r + 5) a -16r2 + 5 b -16r2 +10 c -16r2 -10r d -16r2 - 10 7. 4a (a2 + 7a + 4 a 4a + 28a2 + 16a b 4a3 +28a2 +16a c 4a3 + 44a d 44a4 8. (2y-3) ( 3y-2 a 6y2 - 13y +6 b 6y2 - 13y -6 c 6y2 + 13y -6 d 6y2 + 13y +6 mY ANSWERS ARE B D A

    asked by swaggy
  5. Orgo

    Calculate the approximate boiling point of a mixture of bromobenzene and water at atmospheric pressure. A table of vapor pressure of water and bromobenzene at various temperatures is given. Vapor Pressures (mmHg) Temperature(c) Water Bromobenzene 93 588

    asked by victoria
  6. Accounting

    Temporary investments A.are reported as current assets B.include cash equivalents C.do not include equity securities D.all of the above

    asked by TS
  7. organic chemistry

    Calculate the weight of benzene codistilled with each gram of water and the percentage composition of the vapor produced during a steam distillation. The boiling point of the mixture is 69.4°C. The vapor pressure of water at 69.4°C is 227.7 mmHg. Compare

    asked by victoria
  8. statistics

    14) A population of N = 20 scores has a mean of µ = 15. One score in the population is changed from X = 8 to X =28. What is the value for the new population mean?

    asked by rita
  9. Chemistry

    calculate the rate constant at 225C for a reaction that has a rate constant of 8.1X10^-4 at 95c and an activation enegry of 93.0 kj/mol

    asked by Jason
  10. math

    An invoice is dated August 29 with terms of 4/15 EOM. What is the discount date? (Points : 2.5) 12. What is the net date for the scenario in the previous question? (Points : 2.5)

    asked by douny
  11. math

    the probability of passing an examination is 0.8 what is the probability of failing the examination

    asked by abdulsamad
  12. Calculus

    If an arrow is shot straight up from the surface of the moon with an initial velocity of 100 ft/s, its height in feet after t second is given by s(t)=(100t)−(83/100)(t^2). Use the limit definition of the derivative to find the answers to the following

    asked by Linda
  13. english

    as the nightingale write the diary entry highlighting her fears and analyzing the reasons for her failure -the frog and the nightingale

    asked by sakthi
  14. physics

    A charge of 21 nC is uniformly distributed along a straight rod of length 4.3 m that is bent into a circular arc with a radius of 1.7 m. What is the magnitude of the electric field at the center of curvature of the arc?

    asked by Anonymous
  15. math

    Carolyn tested a coin to see if it was evenly weighted. She flipped the coin 100 times and came up with 42 heads and 58 tails. How does the relative frequency of tails to heads compare to the probability of tails in this experiment? A. The relative

    asked by bubbie
  16. Math

    A jar contains 2 orange balls, 5 black balls, and 3 pink balls. Event A = drawing a black ball on the first draw Event B = drawing a pink ball on the second draw If two balls are drawn from the jar, one after the other without replacement, what is P(A and

    asked by bubbie
  17. Math

    Trent and three friends are ordering a pizza. they play to split the cost and they want to spend at most 3.50 per person. Write and solve an inequality to find the cost of the pizza they should order

    asked by Tristan Lee
  18. Math

    Trent and three friends are ordering a pizza. they play to split the cost and they want to spend at most 3.50 per person. Write and solve an inequality to find the cost of the pizza they should order

    asked by Tristan Lee
  19. business math

    17. Fandango Furniture Manufacturing, Inc. has 40 employees on the assembly line, each with gross earnings of $325 per week. What are the total combined social security and Medicare taxes that should be withheld from the employees’ paychecks each week?

    asked by douny
  20. math

    If the markup of a fluorescent light fixture transformer is 120% based on the cost, what is the corresponding percent markup based on selling price? (Round percent to the nearest tenth.)

    asked by douny
  21. Statistics

    Suppose that A and B are events defined on a common sample space and that the following probabilities are known. Find P(A or B). (Give your answer correct to two decimal places.) P(A) = 0.34, P(B) = 0.41, P(A | B) = 0.2

    asked by Carl
  22. Math

    I need some help with these quesitons 1. a1 = -1, and an = 4/3an-1 for n = 2, 3, 4, ___. What is the common ration, r, for this sequence? 2. A rubber ball is dropped from a height of 50 ft. Assume that each bounce of the ball is vertical and that each

    asked by mysterychicken
  23. math

    A small community college is hoping to raise enough funds to put together an endowment in which the scholarships will be paid for by only the interest earned from the endowment. Assuming they can earn an average of 7.50% for the APR and that only the

    asked by emma
  24. Intermediate algebra, concepts and graphs

    A rectangle is 7 times as long as it is wide. The perimeter is 80 feet. find the dimensions.

    asked by Lisa
  25. Math

    Assume the car can be purchased for 0% down for 60 months (in lieu of rebate). A car with a sticker price of $42,200 with factory and dealer rebates of $5,100 (a) Find the monthly payment if financed for 60 months at 0% APR. (Round your answer to the

    asked by Ronald
  26. computer

    Which of the selections below denotes an Excel formula to add up the data valued within cells D2 through D10?

    asked by Anonymous
  27. Eng

    In which of the following sentences doe you find a verb phrase? A. I shall be all that I am and more B. June was a collector of memorabilia C. I believed every word he said. D. The crowed roared as the bull charged. Answer is "A"

    asked by Jen
  28. math

    What is the net price factor for trade discounts of 25/15/10? (Points : 2.5)

    asked by douny
  29. math

    Ned’s Sheds purchases building materials from Timbertown Lumber for $3,700 with terms of 4/15, n/30. The invoice is dated October 17. Ned’s decides to send in a $2,000 partial payment. By what date must the partial payment be sent to take advantage of

    asked by douny
  30. Chemistry

    C2H6 gas and CO2 gas are contained separately in 1.0 L bottles. What do the gases in the bottles have in common? Assume both gases are at STP

    asked by Maria
  31. Trig

    Find the reference angle θ'. θ= -7pi/9

    asked by John
  32. math

    Find the equations for all vertical asymptotes for the function. y = csc (5x) Is this the right answer x= k pi / 5.

    asked by John
  33. Biostatistics

    Test the potency of a drug on 20 rats. Previous animal show that a 10-mg dose of drug is lethal 5% of the time within 1st 4 hours; of the animals alive at 4 hours, 10% will die in the next 4 hours. What is the probability that 3 or more rats will die in

    asked by Cathy
  34. Biostatistics

    Suppose 2 rats die in the first 4hours. What is the probability that 2 or fewer rats will die in the next 4 hours.

    asked by Cathy
  35. Accounting

    The financial loss that each stockholder in a corporation can incur is usually limited to the amount invested by the stockholder. Answer True False

    asked by TS
  36. math

    the sum of two numbers is 38 . the larger number is 11 more than the half of the smaller number. what are the two numbers? (12,26) (14,24) (18,20) (19,21)

    asked by urvi
  37. math :)

    Jane spins the spinner 10 times in succession.Seven times the spinner lands on an even number. What is the relative frequency that the spinner will land on an odd number? is this 3/10?

    asked by bubbie
  38. Principles of finance

    Faulkner’s Fine Fries Inc (FFF) is thinking about reducing its debt burden. Given the following capital structure information and an expected EBIT of $50 Million (plus or minus 10%) next year, should FFF change their capital structure? FAULKNER'S FINE

    asked by melvin
  39. French

    How do you translate: "May I ask some questions?" into French with correct grammar?

    asked by Erika
  40. math!

    3. Suppose that Jill, at age 24, decides to invest $200 monthly into a portfolio that earns 7% compounded monthly and does this until she turns 34. At age 34 she stops contributing to her portfolio, and just lets it gain the same interest (7% compounded

    asked by emma
  41. Physics

    A compact disc spins at 2.7 revolutions per second. An ant is walking on the CD and finds that it just begins to slide off the CD when it reaches a point 2.6 cm from the CD's center. (a) What is the coefficient of friction between the ant and the CD?

    asked by Gail
  42. math

    Find the measures of two angles, one positive and one negative, that are coterminal with the given angle. 7pi/3

    asked by John
  43. Intermediate algebra, concepts and graphs

    How would I figure out another rectangle equation? The length of a rectangle is 4 meters less than 3 times the width. The perimeter is 24 meters. Find the width.

    asked by Lisa
  44. algebra

    Form a polynomial f(x) with real coefficents having the given degree and zeros Degree 5; Zeros: 2; -i;-7+i Enter the polynomial f(x)=a(____) type expression using x as the variable

    asked by Sharday
  45. maths

    Triangle ABC has an obtuse angle at B, base BC has length equal to 30 and height equal to 24. (This height is taken with respect to base BC). D is a point on the line segment BC and E is a point on AC such that DE∥AB. F is a point on AB such that

    asked by keshav
  46. maths

    Two points X and Y in the xy plane have coordinates (10,5) and (a,b), respectively. The midpoint of the line segment XY has coordinates (13,13). What is the value of a+b?

    asked by vranda
  47. Math

    Find the median and the mean for the data set below. 5.4 2.0 6.8 3.1 2.9 4.7 2.1 5.0 1.9 3.4

    asked by john
  48. calculus

    In the computer game, there must be a ramp that is 2 m wide, with height 3 m and length. 5 m. Assume that one corner of the bottom of the ramp is at the origin.

    asked by ashley
  49. Accounting

    Samuels, Inc. reported net income for 2011 is $105,000. During 2011 the company had 5,000 shares of $100 par, 5% preferred stock and 20,000 of $5 par common stock outstanding. Samuels’ earnings per share for 2011 is Answer $4.00 $5.25 $6.50 $5.00

    asked by TS
  50. Accounting

    At the market close on February 19, 2010, McDonald's Corporation had a closing stock price of $64.74. In addition, McDonald's Corporation had a dividend per share of $2.05 over the previous year. Determine McDonald's Corporation's dividend yield. (Round to

    asked by TS
  51. children's literature

    literature can help learn to clarify problems and:

    asked by tasha
  52. HISTORY

    How is man shaped by the times in which they live. An example of Hitler, Mlk or LBJ, or any leader that was shaped by the times in which they lived.

    asked by renee
  53. Eng

    Which one of the following is a complex sentence? A. I would like to visit the Kinshasa, but I understand the city is unsafe for foreigners. B. As Jake was reading the letter from June yet again, the flight attendant t coughed gently to get his attention.

    asked by Jen
  54. Physics

    What is the factor of safety of a steel hanger having an ultimate strength of 550.000MPa and supporting a load of 64000.000N. The steel hanger in question has a cross sectional area of 7.600cm^2. Answer = (Round to 3 decimal places)

    asked by Danny
  55. Eng

    A clause from sentence (I) has been turned into a (n) _____ in sentence (ii). (i) Since she knew what the lecture was about, she didn't attend the meeting. (ii) Knowing what the lecture was about, she didn't attend the meeting. A. compound predicate B.

    asked by Jen
  56. math

    Fandango Furniture Manufacturing, Inc. has 40 employees on the assembly line, each with gross earnings of $325 per week. What are the total combined social security and Medicare taxes that should be withheld from the employees’ paychecks each week? Using

    asked by douny
  57. math

    At The Luminary, the markup on a halogen light fixture is 50% based on selling price. What is the corresponding percent markup based on cost? If the markup of a fluorescent light fixture transformer is 120% based on the cost, what is the corresponding

    asked by douny
  58. math

    a mouse gathered 32 graph paper squares each one had a side of 1cm she used them to cover a floor it was a rectangle twice as long as wide what are the measurements of the sides

    asked by jen
  59. math

    As you and your spouse are discussing your monthly budget at the dinner table one night, you are both curious as to how much of your $325 car payment is going to principal and how much to interest. Knowing that you are paying an APR of 3.75% to the bank

    asked by emma
  60. algebra

    Use the rational zero theorem to list all possible rational zeros for the given function f(x)=x^3-4x^2-19x-14

    asked by Sharday
  61. Math Trig Find Quadrant I II III IV

    In which quadrant is the terminal side of angle A? A = -5π/6 a. Quadrant III b. Quadrant I c. Quadrant II d. Quadrant IV

    asked by Hello
  62. math

    Can you let me know if I got the correct answer. The question says the expression (10w^3)^2/5w is equivalent to? I got 20w^5 , Is this correct? Thanks

    asked by Gail
  63. Trig

    Find the area of a sector with the given central angle θ in a circle of radius r. θ = 90°, r = 6 cm

    asked by John
  64. algebra

    Find a bound on the real zeros of the polynomial function f(x)=x^4+x^3-4x-6 Every real zero of f lies between ______ and______.

    asked by Sharday
  65. maths

    The integers from 1 through 10 (inclusive) are divided into three groups, each containing at least one number. These groups satisfy the additional property that if x is in a group and 2x≤10, then 2x is in the same group. How many different ways are there

    asked by keshav
  66. maths

    You are planning to lay square tiles on an entire 21125cm by 54925cm rectangular floor without any overlapping. If all the square tiles must be of the same size, what is the least possible number you can lay?

    asked by vranda
  67. math

    express as a decimal correct to four decimal places: 16%

    asked by sigfreid
  68. english

    plz give me solutions of 10 class bbc compehensions answers

    asked by joe
  69. beginning algebra

    the rays won 33 fewer games than twice as many games as they lost. the total games played was 162. how many wins and how many losses did they have?

    asked by Jesse
  70. maths

    the speed of a boat increases from 62 km/h to 80 km/h in 0.9km. What was the acceleration and how long did it take

    asked by ebere
  71. Chemistry- balancing Redox

    Can anyone please assist showing half reactions balancing, balancing of e- and the additions of H2O, H+ and then since its BASIC!!!! the final addition of OHs? Cr(OH)3+ ClO^-=>CrO4^2- +Cl2 THANKS!

    asked by Steve
  72. science

    which sample (salt,fertilizer and sulfuric acid) will have the most algae growth? and why ? which sample (salt,fertilizer and sulfuric acid)will have the most living organisms ? and why?

    asked by john
  73. algebra

    Multipling polynomials: 3x+5yards +3x-5 yards

    asked by Jay
  74. Businees and Technical Writing

    Hello, I have Business and Technical Writing paper and it has me a little stumpped. I just don't know how I can fill the requirements of the paper by the detail scenario given. I am assuming that based on the scenario I can adress the problem as a

    asked by Adrienne
  75. physics

    A uniform sheet of surface current density Ks=Ky ay in z=0 plane. find the magnetic field strength H everywhere using ampere's law.

    asked by amgad
  76. math

    City Cellular purchased $28,900 in cell phones on April 25. The terms of sale were 4/20, 3/30, n/60. Freight terms were F.O.B. destination. Returned goods amounted to $650. What is the net amount due if City Cellular sends the manufacturer a partial

    asked by douny
  77. Intermediate Algebra 137

    Can't figure out equation x/2+x/3=3/4 can you help me step by step.

    asked by Jessica
  78. Statistics

    height shoe size (if you wear men's shoes, add 2) 61 6.5 67 9 63 7 66 8 60 6 71 10 71 11 63 8 63 7 66 62 7 64 6.5 61 7 64 7.5 63 8 58 6.5 63 9 62 6 61 7 74 60 6.5 60 7.5 63 8 Mean 63.73913043 7.571428571 Standard Deviation 3.922167667 1.296974501 H sub 0:

    asked by Armando
  79. Trigonometry

    sin2u+_______x1

    asked by Anonymous
  80. Math

    Can I get some help? 1. If v = (-5, -3), -5 ||v||^2 2. For the following vector v, find ||u||, the unit vector with the same direction angle as v. V = -25j Does u = -j? 3. True or False: To graphically add two vectors, V+w, using the tip-to-tail method,

    asked by mysterychicken
  81. Criminal Justice

    Uncle Bob's vacation discuss the possible communications methods between the officer and his/her agency

    asked by Shaun
  82. English

    e.g. I want to find out more about the smart phone. (In this sentence, what is the part of speech of 'more' Is 'more a noun, a pronoun or an adverb?)

    asked by rfvv
  83. calculus

    find the absolute maximum and minimum of sqrt 3 x^2/36 + (1-x)^2/32

    asked by stan
  84. Physics

    What would happen when a dipole is placed in uniform electric field making an angle theta with the direction of electric field ?

    asked by Aman
  85. chemistry

    1.what are amber light from traffic signal? 2. what are cosmic rays from outer space?

    asked by nick
  86. Physics

    What would happen when a dipole is placed in uniform electric field making an angle theta with the direction of electric field ?

    asked by Sneha
  87. Calculus

    Let f(x)=−4−3x+2x^2. Use the limit definition of the derivative to find find fŒ(a)

    asked by Robin
  88. Chemistry- Dr. Bob again

    Another Redox in BASIC ....having a tough time with these OH's no clue how to tackle. Cr(OH)3 + ClO^- => CrO4^2- +Cl2 thanks for your help

    asked by Steve
  89. A&P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???): !!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG??? 1A. What is its mRNA nucleotide sequence? AGCCCGAUGUUUUGUUUAGUUGCCCCGAGCGUUUGUUUAUUUGCC 1B. Indicate the product

    asked by ISSY
  90. math

    11/16-12/16

    asked by jorge
  91. algebra

    A polynomial f(x) of degree 3 leaves a remainder of 6 when divided by (x+1) and a remainder of 12 when divided by (x-2). Given that the coefficient of x^3 is 2 and (x+2) is the factor of the polynomial. Show that f(x)= 2x^3+3x^2-5x+2

    asked by Everett