Questions Asked on
November 10, 2011

  1. Social Studies 9

    GIVE REASONS WHY BRANT AND THE MOHAWKS THE IROQUOIS AND OTHERS WOULD CHOOSE TO ALLY THEMSELVES WITH THE BRITISH IN THE REVOLUTIONARY WAR. PLEASE I REALLY NEED THIS .

    asked by Stephanie
  2. pre-algebra

    1/9+x=5/6x-3/4

    asked by Ally
  3. algebra

    Find all numbers for which the rational expression is underfined 1.-14/25v 2.s^3-9s/s^2 -64

    asked by lisa
  4. Physic

    A 290-N sphere 0.20 m in radius rolls without slipping 6.0 m down a ramp that is inclined at 31° with the horizontal. What is the angular speed of the sphere at the bottom of the slope if it starts from rest?

    asked by Nikki
  5. English

    What are the main themes in Jews Without Money by Michael Gold and how does Mike overcome his identity crisis?

    asked by Jon
  6. algebra

    a scientist has a 25% acid solution.how many liters of each does the scientist need to make 15L of a solution that is 28%.write a system of equations and solve using any method.

    asked by geena
  7. math

    Given the equation x^2 +y^2+8y-65=0 (a) Write the equation in standard form. (b) State the center, radius, and intercepts. (c) Submit the graph

    asked by tiona
  8. math

    Given the equation x^2 +y^2+8y-65=0 (a) Write the equation in standard form. (b) State the center, radius, and intercepts. (c) Submit the graph

    asked by tiona
  9. math

    . Given the following function, f(x)=-x^2 -8x find: (a) vertex, (b) axis of symmetry, (c) intercepts, (d) domain, (e) range, (f) intervals where the function is increasing, (g) intervals where the function is decreasing, and (h) the graph of the function.

    asked by mz tee
  10. Math

    Solve the equation by factoring, by finding square roots, or by completing the square. 4(x+8)^2=144 I'm not sure if I'm suppose to divide or multiply the 4 to both sides..

    asked by Linda
  11. calculus

    Use Newton's method to approximate the indicated root of the equation correct to six decimal places. The positive root of 3sinx = x^2

    asked by Dakota
  12. Probability

    With her box of 64 crayons, your little sister decides to draw a picture of the family: herself, you, and your parents. How many different ways could she find to give you all hair colors?

    asked by Leanna
  13. managerial economics, market concept

    Celcom can be considered as an oligopoly industry in the telecommunication service provider in Malaysia. Justify the above statement. Thank you

    asked by Miss Cheong
  14. physics

    At the local swimming hole, a favorite trick is to run horizontally off a cliff that is 7.4 m above the water. One diver runs off the edge of the cliff, tucks into a "ball," and rotates on the way down with an average angular speed of 1.6 rev/s. Ignore air

    asked by Marco
  15. physics

    The drive propeller of a ship starts from rest and accelerates at 3.00 10-3 rad/s2 for 2.05 103 s. For the next 1.75 103 s the propeller rotates at a constant angular speed. Then it decelerates at 2.30 10-3 rad/s2 until it slows (without reversing

    asked by Marco
  16. Math

    Random variable X is normally distributed with mean 10 and standard deviation 2. Compute the following probabilities. a. Pr(X

    asked by Sally
  17. Chemistry

    How much heat is released when 10 g of steam at 100°C is cooled to 10 g of liquid water at 100°C? I am working on a practice test and the answer is not in the back of the book. Can some one help me. 1. 10 cal 2. 5400 cal 3. 800 cal 4. 6200 cal

    asked by nan
  18. Genetics

    The following DNA segment has one ORF. Do you know what it codes for? 5'-TAGGATGTTCGACATGTAAGCTT ATCCTACAAGCTGTACATTCGAA

    asked by Tony
  19. science-SCI/230

    This is my first time using Jishka. Well, registering and using the site. I have checked the site when researching class topics we are learning. I don’t think I really have a question but I am looking for clarity of something for class. I just want to

    asked by Nolagrl
  20. physics

    An object 5cm is placed 30cm in front of a concave mirror.The image is 60cm in front of the mirror.Find (a) the focal length of the mirror.(b) the magnification.(c)the size of the image

    asked by chrystabelle
  21. physics

    calculate the refractive index for a ray travelling from air to water given that the angle of incidence is 30degrees and the angle of refraction in the water is 22 degrees.Determine the speed of the ray in water.

    asked by ceasar
  22. Math

    A = h/2 (a+b) the subject of the given formula is "a" not "A" please include workings (along with solution) thanks

    asked by ASDFGHJKL;
  23. Math

    S = n/2 (a+1) The subject of the formula is L Same as before, please include workings TYVM

    asked by ASDFGHJKL;
  24. Math

    Sorry for repeated questions, but this is my last problem: s = ut + 1/2(gt) The "t" for "gt" is squared, and the subject of the formula is "u". Thank you very much (and please include workings).

    asked by ASDFGHJKL;
  25. MAth grade 8

    Meiling and meimei divide $69 to 2 shares. 3/4 meiling's share is equal to 2/5 of meimei's share. how much do they each get

    asked by Aldwin
  26. math

    A marathon runner ran 26.2 miles in 2 h 30 min. Find these rates: a. miles per hour b. miles per minute c. minutes per mile

    asked by missy
  27. PHYSICS

    An astronomical telescope has an objective lens of 80cm and an eyepiece of 5cm focal length.If the final image is formed 25cm from the eye piece when a distant object is viewed by the eye close to the eyepiece,determine the magnifying power of the

    asked by ceasar1
  28. Probability

    With her box of 64 crayons, your little sister decides to draw a picture of the family: herself, you, and your parents. How many different ways could she find to give you all hair colors?

    asked by Leanna
  29. Physics(wave motion and propagation)

    A uniform heavy rope hangs freely from a support. the support is made to oscillate horizontally with a small amplitude so as to send transverse waves down the rope.A standing wave is set up as these waves are reflected at the free end.Which of the

    asked by Kon
  30. physics

    an object of mass 150kg is pulled on a horizontal rough ground by a force of 900newton(N).find the coefficient of static friction (taken g=10m/s)

    asked by john emmanuel
  31. Math

    What is the zero of x^3+1/x^2-1 (my answer is -1. Is that correct?) please help

    asked by Meron
  32. physics

    To verify her suspicion that a rock specimen is hollow,a geologist weighs the specimen in air and in water.She finds that the specimen weighs twice as much in air as it does in water.The solid part of the specimen has a density of 5 multiplied by

    asked by chrystabelle
  33. math

    Simplify: (a) 4ã7 (2ã3 +3ã6 -ã7 ) (b) (3ã7 -ã2 )squared (c) (16ã24)/(4ã96) (d) 7/(ã20 ) - 4/(ã12) (e) (3ã2)/(ã12) - (5ã3)/(ã8 )

    asked by muma
  34. MAth grade 8

    mr kumar lives in the eastern part of spore . he visits his aged parents , who lives 36 km away , every weekend he finds that is he increases the average speed of his vehicle by 12km/h, he could save 9 minutes of his travelling time. find the speed at

    asked by Aldwin
  35. MAth grade 8

    mary's age is 2/3 of peter's. Two years ago mary's age was 1/2 of what peter's age will be in 5 years time. How old is peter now?

    asked by 17halimk
  36. math

    Integral from 0 to pi/6 of (sin x + cos x) less than or equal to pi(square root 3 + 1)/12

    asked by suhaib
  37. information literacy

    According to fedstats,found in Virtual Reference room,what was the number of building Permits in 2009

    asked by lisa clem
  38. ALGEBRA

    9/16-(-3/16) subtract show all of your work. simplify

    asked by Angela
  39. ALGEBRA

    -8/9*27 multiply. show all of your work.

    asked by Angela
  40. ALGEBRA

    -1/10 state the reciprocal.

    asked by Angela
  41. Math

    What woul be the function table and rules for 13, 21, and 45?

    asked by SLb
  42. english

    would you please tell me a few lines on the topic ' survival of english language'

    asked by R S Telagathoty
  43. algebra

    simplify 5+5^2(23)-(-27)

    asked by Angela
  44. algebra

    3b-(-12-b)

    asked by Angela
  45. algebra

    c-(c^2)-7 for c=-6

    asked by Angela
  46. algebra

    simplify 0.1/0

    asked by Angela
  47. algebra

    simplify (-19)^2

    asked by Angela
  48. algebra

    add -90+17

    asked by Angela
  49. algebra

    write the wxpression using exponents. m*m

    asked by Angela
  50. ALGEBRA

    write the expression using exponents m*m

    asked by Angela
  51. accounting

    Your company manufactures specialty items. In order to reduce any loss from a customer canceling an order after production has been started, your company requests a 50% deposit before it will start the manufacturing process. On January 3, you get an order

    asked by Deb
  52. Math

    Sam drives his car 23,040 miles per year. Find this rate in the number of miles driven per month, to the nearest mile

    asked by Christina
  53. Science

    I just need to know if i got these right? 1.If we take out parts of our ecosystem, then other parts of it are affected. A. True B.False 2.All animals have the same risk of extinction. A.True B.False I think 1 is false and 2.is true

    asked by Anonymous
  54. Science

    3. Which factor below helps species avoid extinction? A. Low reproductive rates B. high economic importance C. limited habitats in which to live D. able to adapt to changes in their habitat I think its D. 4. If there continues to be a loss in biodiversity

    asked by Anonymous
  55. algebra

    Please I need help! Solve and simplify: x^2+14x-4=0

    asked by jane
  56. algebra

    I do npot understand how to do this problem, please help: 4y/y^2-y/y-3

    asked by jane
  57. algebra

    Need help. please help: Solve and simplify, use comma to separate answers: sqrt:9x+55=x+5

    asked by jane
  58. Law

    Many notable characters, songs, and movies that were previously set to enter into the public domain have not as of yet due to repeated extensions of the copyright laws that have extended protections. Many of the Disney characters, including Mickey Mouse,

    asked by Bryan
  59. algebra

    Please help: If the sides of a square are lingthened by 7cm, the area becomes 169cm^2. Fine thelength of a side of the orginal square.

    asked by jane
  60. math

    Please graph your response to question 2 on a separate piece of paper. When finished, click "submit" to view the correct answer. Graph each rational number on a number line. , -, 1.5, 0.4

    asked by Anonymous
  61. General

    Could someone hope to avoid the obligations of contract on grounds that a ad was a misleading inducement to sign the contract?

    asked by Bryan
  62. literacy

    Search on Ed-seeker's home page thor*and dinosaurs*and extinca Which Artical title represents a citatation under the news results?

    asked by lisa clem
  63. biology

    One advantage of electron microscopes over light microscopes is their _____. A. size B. higher magnification C. two-dimensional image D. use of live specimens

    asked by lola
  64. business

    plz plz help me with my assignment. This is the assignment:- •Your favorite cousin has moved to your town and is looking for a job. •Her previous experiences are working as a cashier and sales clerk at two department stores. •You know she plans to

    asked by jinal
  65. calculus

    Find the volume V of the described solid S. The base of S is a circular disk with radius 2r. Parallel cross-sections perpendicular to the base are squares.

    asked by Johnathon
  66. calculus

    Find the volume V of the described solid S. The base of S is an elliptical region with boundary curve 9x2 + 25y2 = 225. Cross-sections perpendicular to the x-axis are isosceles right triangles with hypotenuse in the base.

    asked by Johnathon
  67. calculus

    Find the volume V of the described solid S. The base of S is the region enclosed by the parabola y = 3 − 2x2 and the x−axis. Cross-sections perpendicular to the y−axis are squares.

    asked by Johnathon
  68. statistics

    an industrial designer wants to determinethe average amount of time it takes an adult to assemble an easy-to- assembletoy .use the following data (inminites)a random sample, to construct a 95% confidence interval for the mean of the population sampled:17

    asked by pierre
  69. math

    Write an equation that has a slope of -2/3 in Point-slope form and Slope-intercept form.

    asked by Jane
  70. Geometry

    what is the lateral area of a regular pyramid with a 6 inch width and a 8 inch height

    asked by James
  71. physics

    An object of mass 250g attached to the end of string is whirled round in horizontal circle of radius 20cm with a constant speed of 12m/s calculate centripetal accelaration centripetal force angular velocity

    asked by Anonymous
  72. french

    for my homework we had to write a paragraph on what we do to help out around the house could you please let me know if there are grammar or spelling mistakes and tell me where i made mistakes and what i should have said instead Pour aider autour de la

    asked by Ellie
  73. accounting

    Why can't reversing entries be used on cash accounts?

    asked by babs
  74. Business Law Society

    Would the result in the 99 Cents Only Stores V. Lancaster Redevelopment be any different today after the Supreme Court’s 2005 decision in the new London, Connecticut, case

    asked by Colby
  75. algebra

    Given f(x) and g(x) below, find: (a) f+ g (b) f- g (c) f*g (d)f/g Please show all of your work. f(x) = ãx g(x) = 6x-5

    asked by julz
  76. Health

    30. There is a cure for STDs caused by a virus -True? 34. Donating blood puts a person at risk for contracting HIV -False? Thanks -MC

    asked by mysterychicken
  77. Mathematics

    An object of mass 250g attached to the end of string is whirled round in horizotal circle of radius 20cm with a constant speed of 12m/s caleculate centipetal accelaration centripetal force angular velocity

    asked by Eze
  78. English

    I urgently need you to check these few sentences.I need to reword sentence two. I need to convince them to start a partnership with our school. 1)Thank you very much for your last e-mail. I really hope your teachers will agree to work on a common project

    asked by Henry2
  79. Geomatry

    In triangle ABC, angle Bis five less than twice angle A and angle Cis sixty less than angle B. What is the measurment of all of the triangles angles?

    asked by Angelique
  80. translat english to french

    what ido after school when i close from school i eat my snack and itake my bath for the afternoon then i rest for some thirty minutes atfer taking my short rest i join my mother in the kitchen toprepare dinner on days that i do nothave private studies but

    asked by stephen
  81. geometry

    Quadrilateral XYZW IS A RECTENGULAR. If XY+YZ=7 AND XZ+YW=10, SO FIND XY?

    asked by Anonymous
  82. Mathematics

    An object of mass 250g attached to the end of string is whirled round in horizotal circle of radius 20cm with a constant speed of 12m/s caleculate centipetal accelaration centripetal force angular velocity

    asked by Eze
  83. geometry

    Quadrilateral XYZW IS A RECTENGULAR. If XY+YZ=7 AND XZ+YW=10, SO FIND XY? Give answers

    asked by Anonymous
  84. ALGEBRA

    STATE THE RECIPROCAL. -1/10 MY ANSWER IS -10 I need to know if I am on the right track.

    asked by Angela
  85. Statistics

    Suppose the heights of women aged 20 to 29 follow approximately the N(66.7, 2.4) distribution. Also suppose men the same age have heights distributed as N(70.5, 2.2). What percent (± 0.1) of young men are shorter than average young women?

    asked by Kelly
  86. ALGEBRA

    SIMPLIFY 0.1/O i GOT 0 FOR THE ANSWER BECAUSE ANY NEMBER DIVIDED BY 0 IS UNDEFINED IS THAT CORRECT.

    asked by Angela
  87. English

    I forgot to add these few more things. They are really urgent. Thank you. 1) I told my collegues about the possibility of carrying out a Comenius project on how to write the screenplay and shoot (make) a film. 2) As a matter of fact, they would rather be

    asked by Henry2
  88. advance algebra

    how to find the lcm of 15,27

    asked by Charles
  89. ALGEBRA

    9/16-(-3/16) SUBTRACT SHOW ALL OF YOUR WORK SIMPLIFY tHIS IS WHAT I GOT. 9/16+3/16=12/16=3/4 IS WHT I got.

    asked by Angela
  90. Statistic & Probability

    17. Determine the appropriate approach to conduct a hypothesis test for this claim: The systolic blood pressure of men who run at least five miles each week varies less than does the systolic blood pressure of all men. Sample data: n = 100 randomly

    asked by Bori
  91. Science

    If i am provided with a supply of 2M of sulphuric acid,how can i explain how to prepare 500ml of 0.5M sulphuric?

    asked by Abbie
  92. Imaginary land Homework poster

    create a 2-D or 3 -D imaginary land. Land must include at least 5 of the following landforms: volcano, mountain range, plateau, valley, island, lake, peninsula, plain, and river to create a SNAZZY name.

    asked by gracie
  93. History of America

    What were the circumstances under which the containment policy was first used? Can you give me some kind of link or help for this question?

    asked by anonymous
  94. Chemistry

    3.15 g of an unknown gas at 53 °C and 1.00 atm is stored in a 1.55-L flask. The gas has a density of 2.03 g/L. What is the molar mass of the gas?

    asked by Harley
  95. Javascript

    I need help these javascript exericses: Input: A text string, using prompt. Output: Either "Valid name" or "Invalid name", depending on whether the input names fit the required format, which is Last name,first name, middle initial where neither of the

    asked by Mike
  96. social studies

    True or False? "Containment" was the underlying cause of the Korean War. I think it may be false because there were many causes of the Korean War.

    asked by anonymous
  97. English

    I need you to check these expressions. 1) Don't keep/leave them waiting outside. Try to hurry up. 2) I suggest your going to the chemist's. 3) In my town there are two chemist's, a tobacconist's and two cafes. 4)He excused my arriving late. 5) The

    asked by Henry2
  98. math

    how many rectangles can you make with 72

    asked by logan dilley
  99. Social Care courses

    Where can I make a complaint about the provider of mandatory courses like Tutorcare? Thank you!

    asked by Codruta
  100. math

    In her art class, Ms. Walter has 12 students whose ages are listed below: 19, 20, 20, 20, 21, 22, 24, 24, 25, 25, 56, 60 She calculated the mean and the median of their ages. What is the relationship between these two values?

    asked by Sally
  101. Grammar

    1. Neither the fracture nor the lacerations __________ surgery. A) require B) requires 2. He wondered __________ he should see about his abdominal pain. A) who B) whom 3. The patient and __________ were lifted carefully onto a stretcher. A) her B) she 4.

    asked by Cindy
  102. chem

    Is there any simple way to predict the volume of a second back titration done on a particular antacid substance after completing a titration the first time around?..Thank you every one for responses.

    asked by kat
  103. calculus

    A recatangle has constant area of 200 square meters and its lenght L is increasing at the rate of 4 meters per second a) find the width W at the instant that the width is decreasing at the rate of .5 meters per second b) at what rate is the diagonal d of

    asked by Demetria
  104. biology

    The causes of cancer may include which of the following? A. environmental influences B. UV radiation C. viruses D. all of the above

    asked by lola
  105. fundamental of organizational communication

    can some assist me with this assignment? It is time to choose an organizational communication scenario to use as the case study for your final project. Most learners choose a problem or issue they are experiencing at their current workplace, but you may

    asked by Hope
  106. Organic Chemistry

    5. Look up the density of n-butyl chloride (1-chlorobutane). Assume that this alkyl halide was prepared instead of the bromide. Decide whether the alkyl chloride would appear as the upper or lower phase at each stage of the separation procedure: after the

    asked by Scarlet
  107. Learning Log

    Space betweenyour fingers time capsule

    asked by Viji
  108. Intro to food preperation

    does boiling food items help elinminate calories and impurities

    asked by Aran
  109. business

    I need a help on my assignment- This is my assignment - 1.Ten years ago, you started working as a clerk for DMD Medical Supplies. 2.Six months ago, Liz Jakowski, the human resources director, promoted you to office manager. You manage two employees: Jack

    asked by richa
  110. G.c.c.mkd physics

    A 5kg mass is dropped from a height of 30m above the ground. Determine the velocity of the mass when it is 18n above the ground take = 10m/s2

    asked by Wisdom
  111. Psy

    Professor Klinger says that all of your ideas come from interaction with the environment rather than anything that you were born with. The professor is advocating a theoretical perspective based on a(n)___ view. A) tabula rasa b) contemporary c) moral d)

    asked by Angela
  112. physics

    A coin 1.9 cm in diameter is held 40 cm from a concave spherical mirror of 30 cm radius of curvature. Locate the image of the coin Then what is the diameter of coin?

    asked by TP
  113. English - Drawing conclusions

    jon is tony cousin. Tony is hanks newphew. How are hank and jon related?

    asked by Lala
  114. New wonders of the world

    What are some special facts such as the dates, why it was built or etc. of the new wonders of the world?

    asked by Jewel
  115. physics

    A 8.20 cm tall object is placed 30.0 cm in front of a concave mirror with a focal length of 4.20 cm. What is the magnification?

    asked by TP
  116. Physics

    A 4.40-kg model rocket is launched, shooting 53.0 g of burned fuel from its exhaust at an average velocity of 650 m/s. What is the velocity of the rocket after the fuel has burned? (Ignore effects of gravity and air resistance.)

    asked by Eddie
  117. Physics

    A 4.40-kg model rocket is launched, shooting 53.0 g of burned fuel from its exhaust at an average velocity of 650 m/s. What is the velocity of the rocket after the fuel has burned? (Ignore effects of gravity and air resistance.)

    asked by Eddie
  118. Physics

    A 4.40-kg model rocket is launched, shooting 53.0 g of burned fuel from its exhaust at an average velocity of 650 m/s. What is the velocity of the rocket after the fuel has burned? (Ignore effects of gravity and air resistance.)

    asked by Eddie
  119. Physics

    A 4.40-kg model rocket is launched, shooting 53.0 g of burned fuel from its exhaust at an average velocity of 650 m/s. What is the velocity of the rocket after the fuel has burned? (Ignore effects of gravity and air resistance.)

    asked by Eddie
  120. math

    If 60 seconds are in a minute, 60 minutes in an hour, and 24 hours in a day, then 86,400 seconds are in a day. What type of reasoning is this? inductive deductive

    asked by Anonymous
  121. Algebra 2

    Simplify a(-2)power divided by b(6)power times c(-8)power so there are no negative exponents

    asked by Fred
  122. physics

    A 2500kg gun fires a 10.0kg projectile with a muzzle speed of 550m/s. A) determine the initial recoil speed of the gun B) If the recoil is against a constant resisting force of 4200N, find the time taken to bring the gun to rest.

    asked by b
  123. Chemistry

    In the experiment shown below, you add some salt to water. A = All of the solid dissolves (no solid at the bottom). B = You add more water and the solid stays dissolved. Select all of the following that are true about solutions A and B. The same number of

    asked by Rachel
  124. physics.pls help

    A 100g bird siis in its nest. what is the Fnet(net force) in this case?

    asked by ted
  125. Math

    A floor-finishing machine uses bars of wax. Once the bar is worn down to 1/2 its original size, it must be replaced with a new bar. Only full-size bars can be put in the machine. The pieces are melted and recycled to make full-size bars. If you buy 24 bars

    asked by Sue
  126. Math

    Four good friends, who love cats, have each named their cat after one of the other friends. Of the clues that follow, only one is true; the others are false. Which friend owns which cat? a.Candy’s cat is named either Dody or Alice. b.Betsy’s cat is

    asked by Bean
  127. Math

    Lalph Rauren was famous for discovering potential models as he walked the streets of New York. One day he spotted four girls who later became top models: Amy, Mary, Kay, and Beth. One was discovered walking through an apartment building, one in a coffee

    asked by James
  128. CHEMISTRY

    Strong base is dissolved in 675 ml of 0.200 m weak acid (ka=3.25x10^-5) to make a buffer with a ph of 3.95. Assume that the volume remains constant when the base is added. HA + OH ---> H2O + A^- calculate the pka value of the acid and determine the number

    asked by Alexander
  129. Math

    For each of the following draw a Venn diagram for sets A, B, and C that satisfies the given conditions: a.Draw a Venn diagram for sets A, B, and C such that b.Draw a Venn diagram for sets A, B, and C such that

    asked by Mike
  130. Math

    A famous detective was called in to solve a baffling murder mystery. He determined there was only one cause of death along with the following facts: a.Mr. Harold, the murdered man, was killed by a blow on the head with a brass candlestick. b.Either his

    asked by Laura
  131. algebra

    If Marcy received a 7% raise and is now making $67,500 per year, what was her salary before the raise? Round your answer to the nearest dollar.

    asked by Anonymous
  132. Social Studies

    Eli Whitney revolutionized industry in the north and south and impacted the Civil War. What 2 key innovations is he attributed with?

    asked by john
  133. persuasive

    For my persuasive speech on abortion, I am having trouble deciding a topic using fact, value, OR policy proposition. I understand what all three of those are, but I don't know what would be the most suitable for my topic (Pro-life, against abortion) I need

    asked by y912f
  134. government-pos110

    Which of the following characterizes the differences between House and Senate campaigns? a.House campaigns have more funding than Senate campaigns. b.House campaigns are less contested than Senate campaigns. c.House campaigns are less affected by the

    asked by Michelle
  135. reading

    whay would a leaf be a good rug for a lady bug

    asked by rachel
  136. English

    Soldiers carried several days cold nations. should days chage to a possessive noun from days to days'

    asked by Chris
  137. history

    why did new political movements and philosophies develop during the industrial revolution

    asked by charlita
  138. Math

    Which of the following does not always bisect at least one side?

    asked by Fabiana
  139. physics

    A screen is placed exactly one meter away from an illuminated test pattern. A lens placed between them forms a clear (focused) image of the pattern on the screen when the center of the lens is 200 mm from the test pattern. What is the focal length of the

    asked by TP
  140. World Geography

    What websites will have information on Switerland Attractinos? I need to find 4 Attractions. A Religious, Cultural, Physical(Natural), and a Historical one.

    asked by Lilly
  141. stats

    This week we practice with Binomial Distribution. You can use Appendix Table E or Excel Function Binomdist. About 30% of adults in United States have college degree. (probability that person has college degree is p = 0.30). If N adults are randomly

    asked by mary
  142. precalculus

    please explain how to graph a rational function using transformation and demonstrate by providing an example. Thank you!

    asked by mz tee
  143. physics.pls help

    A 100g bird sits in its nest. what is the Fnet(net force) in this case? pls help

    asked by ted
  144. Chemistry

    Hi, I have to draw a dot and cross diagram for NH2+ and then state the bond angles. I have done NH2-, but I am not sure how to do the + one.

    asked by Carol
  145. physics

    A 1.0kg ball initially at rest rolls down a plane at 35 degrees. pls i really need help

    asked by ted
  146. Math

    What is the volume of a cone with a radius of 3 cm and a height of 6 cm? I can't get this one right for some reason!

    asked by Valentina
  147. English

    Could you please check my sentences? Thank you. 1) What organization does the interviewee work for? 2) Why do endangered species serve as umbrella species? What poses the most serious hazard for the North Atlantic whales? 3) Which is the most successful

    asked by Henry2
  148. Chemistry

    fast no+no-->n2o2, slow n2o2+h2-->n2o+h20, fast n2o+h2-->n2+h2o 1)What is the intermediates in the rxn 2)Write the rate law for this process

    asked by Tarkan
  149. math

    A roll of fabric was 144 inches long. A customer bought 2 feet of the fabric. How many feet of fabric were remaining?

    asked by Sanaya
  150. chemistry

    What are emission spectra?

    asked by mike
  151. Shirley English 3 rd grad

    My daughter is working on Fragments and Correcting Run ON Sentences by SCV, SCS, and SS and she did not bring home her book. I have no idea what SCV and SCS and SS means! Can you please help?

    asked by Jackie
  152. math

    A floor-finishing machine uses bars of wax. Once the bar is worn down to 1/2 its original size, it must be replaced with a new bar. Only full-size bars can be put in the machine. The pieces are melted and recycled to make full-size bars. If you buy 24 bars

    asked by Dell
  153. math

    A sack of sand measures 21 kilograms and 714 grams,and a sack of yard clippings measures 7 kilograms and 192 grams. How much more does the sack of sand measure than the sack of yard clippings?

    asked by Sanaya
  154. Chemistry HELP

    fast no+no-->n2o2, slow n2o2+h2-->n2o+h20, fast n2o+h2-->n2+h2o 1)What is the intermediates in the rxn 2)Write the rate law for this process

    asked by Tarkan
  155. math

    in a class of 30 students, 17 have computers at home and 20 have cassettes. If 4 students in the class have neither a computer or a cassette, how many of the 30 students have both?

    asked by stacey
  156. pre-calc

    analyzing the motion of a projectile: a projectile is fired from a cliff 200 feet above the water at an inclination of 45 degrees, with a muzzle velocity of 50 feet per second. the height of the projectile above the water is given by h(x)= -0.0128x^2+x+200

    asked by steph
  157. math

    Levi worked in his neighbor's yard for 7 hours trimming the trees. After trimming, he bagged up the trimmings in 38 minutes. How many minutes did he work in the yard altogether?

    asked by Sanaya
  158. 7th Grade English

    I have this project for english about the PTA Reflections. Ok you see we have to write a 5 paragraph essay in which I discuss what you believe diversity means. Be sure yo have a topic sentence for each new paragraph, and provide supporting details. Please

    asked by Laruen
  159. English

    Here's my question: Is the statement, "I hate you more than you hate me", grammatically correct? Also, can you suggest another statement of the same thought/meaning? Thanks in advance.

    asked by Namie
  160. chemistry

    What are emission spectra? Is it correct to say . The pattern of spectral emission lines produced by an element.Each element has his own unique emission spectrum. What do you think?

    asked by mike
  161. math

    Dan had to complete the remaining 1/3 of his science project this week. On Monday, he completed 4/5 of the work he had left to do. What part of the entire project did Dan complete on Monday?

    asked by Maria
  162. physics

    A 9.90-g bullet has a speed of 1.33 km/s. (a) What is its kinetic energy in joules? (b) What is the bullet's kinetic energy if its speed is halved? (c) What is the bullet's kinetic energy if its speed is doubled?

    asked by Jonathan
  163. physics

    A 1.0kg ball initially at rest rolls down a plane at 35 degrees. Find the net force. pls i really need help

    asked by ted
  164. Science

    When a sound wave passes from air into a solid object, which of the following wave properties change? -frequency -wave speed -amplitude -wave length Can be more than one

    asked by Logan
  165. math

    A team is made up of 6th 7th and 8th graders in the ratio of 234. How many 6th graders will be on a 36member team?

    asked by brandon
  166. physics

    A 9.90-g bullet has a speed of 1.33 km/s. (a) What is its kinetic energy in joules? (b) What is the bullet's kinetic energy if its speed is halved? (c) What is the bullet's kinetic energy if its speed is doubled?

    asked by Jonathan
  167. physics

    Two satellites are in orbit around Mars with the same orbital radius. Satellite 2 has twice the mass of satellite 1. What is the centripetal acceleration of satellite?

    asked by susan
  168. physics

    To enter the main pool at an amusement part, a swimmer uses a water slide which has a vertical height of 2.65 m. Find her speed at the bottom of the slide if she starts with an initial speed of 0.950 m/s.

    asked by Jonathan
  169. spanish

    is this past or present tense Mi Papa escribio un cheque

    asked by josh
  170. math2

    Dan had to complete the remaining 1/3 of his science project this week. On Monday, he completed 4/5 of the work he had left to do. What part of the entire project did Dan complete on Monday? Can you guide me on how to figure it out?

    asked by Maria
  171. Chemistry

    How many water molecules are associated with Mg^2+ and how many are associated with SO4^2- in the structure MgSO4 x 7H2O? Please help I am very confused by this question

    asked by Rebecca
  172. Curious Question

    What does BQ means??? Everytime Im on the computer googling stuff I see that. What does it means ????

    asked by Laruen
  173. English Literature

    What part of her appearance does Hermia believe Helena has exploited to win Lysander’s love?

    asked by Mia
  174. chemistry

    A 42.3-L volume of methane gas is heated from 25°C to 76°C at constant pressure. What is the final volume of the gas?

    asked by li
  175. math

    Jennie and Millie are sister gorillas. Jennie is 57 kilograms and 663 grams,and Millie is 113 kilograms and 181 grams. How much do the sister gorillas weigh together?

    asked by Sanaya
  176. Math

    Given the following frequency distribution, find the mean, variance, and standard deviation. Class Frequency 31-33 18 34-36 25

    asked by Jennifer
  177. math

    is $9.00 greater than or less than the exact answer?

    asked by Anonymous
  178. Math

    Given the following frequency distribution, find the mean, variance, and standard deviation. Class Frequency 31-33 18 34-36 25 37-39 22 40-42 9 43-45 20

    asked by Jennifer
  179. Math

    The following data lists the average monthly snowfall for January in 15 cities around the US: 42 45 8 18 45 15 31 46 3 33 2 6 32 47 36 Find the mean, variance, and standard deviation.

    asked by Jennifer
  180. Math

    Rank the following data in increasing order and find the positions and values of both the 39th percentile and 67th percentile. 5 9 9 0 7 2 5 6 9 1 0 6

    asked by Jennifer
  181. Math

    For the table that follows, answer the following questions: x y 1 -8 2 -11 3 -14 4 - Would the correlation between x and y in the table above be positive or negative? - Find the missing value of y in the table. - How would the values of this table be

    asked by Jennifer
  182. Physics-please

    When a sound wave passes from air into a solid object, which of the following wave properties change? -Frequency -Wave Speed -Amplitude -Wavelength all that apply

    asked by Logan
  183. math

    Holly ordered 3 pounds and 11 ounces of roast beef and 4 pounds and 10 ounces of ham. How much meat did Holly order?

    asked by Sanaya
  184. pre- calc

    area of a parking lot: One campus of Houston community college has plans to construct a rectangular parking lot on land bordered on one side by a highway. there are 640 feet of fencing available to fence the sides. let x represent the length of each off

    asked by steph
  185. chemistry

    From data below, calculate the total heat (J) needed to convert 0.172 mol of gaseous ethanol (C2H6O) at 451° C and 1 atm to liquid ethanol at 25.0° C and 1 atm. Boiling point at 1 atm 78.5°C cgas 1.43 J/g · °C cliquid 2.45 J/g · °C ΔH°vap 40.5

    asked by Celeste
  186. Operations Management

    Determine the placement of departments for a newly designed facility that will minimize total transportation costs using the data in the following tables. Assume that reverse distances are the same. The locations are shown in the grid. Use a cost of $1 per

    asked by kim
  187. calculus

    The population of a country was 8.4 million people in 2000. Three years later, the population of the same nation was 9.3 million people. Assuming that population is growing exponentially, what is the projected population (rounded to one-tenth of a million)

    asked by Dave
  188. Please Help!!!!!!

    a hot air balloon is rising vertically 10 ft/sec while the wind is blowing horizontally 5ft/sec. Find the speed of the balloon and the angle x that it makes with the horizontal. I know that the speed of the balloon is the square root of (10)^2 + (5)^2, but

    asked by Ashley
  189. pre-calc

    path of a frogs leap: a frog leaps from a box 3 feet high and lands 4 feet from the base of the stump. we can consider the initial position of the frog to be at (0,3) and its landing position to be at (4,0). it is determined that the height of the frog as

    asked by steph
  190. ipc

    your brother and you decide to swing and u push him and he reahed a max speed of 15m/s how high is he a his highest point on the swing?

    asked by cort
  191. English

    How can I describe my impression of a painting? The painting shows a freeway and the main focus is the crash site, where there is smoke and fire.

    asked by Anonymous
  192. math

    For each of the following draw a Venn diagram for sets A, B, and C that satisfies the given conditions: a. Draw a Venn diagram for sets A, B, and C such that A⊆B;C⊆B;A and C have no elements in common b. Draw a Venn diagram for sets A, B, and C such

    asked by Anonymous
  193. pre-calc

    Physics: a ball is thrown vertically upward with an initial velocity of 80 feet per second. the distance (in feet) of the ball from the ground after t seconds if s=80t-16tt^2 a) draw the illustration b) for what time interval is the ball more than 96 feet

    asked by steph
  194. human life

    what does to give your time mean?

    asked by firdows
  195. Math, Please Help!!!

    a hot air balloon is rising vertically 10 ft/sec while the wind is blowing horizontally 5ft/sec. Find the speed of the balloon and the angle x that it makes with the horizontal. I know that the speed of the balloon is the square root of (10)^2 + (5)^2, but

    asked by Jenny Star
  196. psy

    Anna, an adolescent girl, is very much in love with her boyfriend who is three years older than she. He is putting a lot of pressure on her to have sex. At the same time, she is anxious about her parents’ attitude towards her boyfriend. Her mother

    asked by lisa
  197. Assignment help (chemistry)

    in the reaction, N2O4-->2NO2, if the rate of formation of NO2 were 0.010 mol/L*s,, what would be the rate of decomposition for N2O4 Plz show steps thx

    asked by Tarkan
  198. pre-calc

    construction of a rain gutter: a piece of rectangular sheet metal is 20 inches wide. it is to be made into a rain gutter by turning the edges to form parallel sides. let x represent the length of each of the parallel. a) give the restrictions on x. b)

    asked by steph
  199. 4th grade math

    Please help solve this word problem Sara traced circle stencils for her project. She needs 7 rows of 9 circle stencils. She thought that 7 rows of 9 is the same as 3 rows of 9 and 2 rows of 9. Is this correct? Thanks

    asked by Zack
  200. math

    Use fraction bars to find the difference. Write the answer in simplest form. 4 1/2 - 3 2/3

    asked by stephanie
  201. psy

    yes i would I also have two others also this is everything. · Anna, an adolescent girl, is very much in love with her boyfriend who is three years older than she. He is putting a lot of pressure on her to have sex. At the same time, she is anxious about

    asked by Miss Lisa
  202. chemistry

    a 25.0ml dsmplr og 0.105M HCI was titrated with 31.5ml of NaOH. What is the concentration of the NaOH I got 0.0834M am I correct HCI + NaOH -----> H20 + NaCl 25.0ml HCI x 1L/1000mlx0.105 mol HCI/1L HCI X 1 mol NaOH/ I mol HCI = 0.0834M

    asked by Monique
  203. math

    Faith's recipe makes 5 quarts of fruit punch. If the cranberry juice is not included, how much punch is made?

    asked by stephanie
  204. Finance

    Company A wants to issue new 20-year bonds for needed projects. The company currently has 10 percent coupong bonds on the market that sell for $1,063, make semiannual payments, and mature in 20 years. What coupon rate should the company set on its new

    asked by Candy
  205. Chemistry

    Hi Everyone, Please Give me two examples of organic compound that have two different functional side groups groups. Please list the functional side groups for each organic compound.

    asked by Allan
  206. chemistry

    If pure water cant conduct electricity why do we have to be careful with electrical appliances near water.

    asked by Monique
  207. Math, Please Help!!!

    a hot air balloon is rising vertically 10 ft/sec while the wind is blowing horizontally 5ft/sec. Find the speed of the balloon and the angle x that it makes with the horizontal. I know that the speed of the balloon is the square root of (10)^2 + (5)^2, but

    asked by BOB
  208. physics

    it takes 100 N to pull and object up an inclined plane. the gravitional force on the object is 600 N what is the load force in this case? what is the effort force in this case? what is the mechanical advantage?

    asked by mdm
  209. Psychology

    If psychological needs have presumptive brain or physiological correlates, are they still psychological needs?

    asked by summer
  210. psy

    Outline, in a response, the main points that a therapist might cover in a counseling session to help each individual for each scenario. Your response should be 700 to 1,050 words in length. · Anna, an adolescent girl, is very much in love with her

    asked by marie
  211. History!

    Was the United States “correct” in considering the Soviet Union to be a threat following the Second World War?

    asked by A
  212. eng 125

    How is the more direct performative aspect of drama and/or poetry reflected in these forms?

    asked by andre
  213. History!

    What do you think was the greatest foreign policy issue between 1945 and 1960?

    asked by A
  214. History!

    Could you consider Khrushchev argument in the “Kitchen Debate” to be advocating for greater equality for women? Why or why not?

    asked by A
  215. math

    Web Results For:The ratio of john's money to Peter's money was 4:7 at first. After john spent 1/2 of his money and Peter spent $60. Peter had twice as much money as john. How much money did john have at first?

    asked by carol
  216. history

    After about 1700, indentured servants were no longer employed as they had been in the past. What developments led to this change? Why?

    asked by nichole
  217. health

    Your community leaders have noticed an increase in positive STD test reports from the CDC. The nearest health department is more than 30 miles from your community. How might a community become involved in making public health interventions more effective

    asked by Patricia
  218. Plzz help me

    the reaction BrO3- + 3SO3 2- ---> has the rate law r= k[BrO3-][SO3 2-]. what is the order of the reaction with the respect to each reactant? wat s the overall order of the reaction?

    asked by Tarkan
  219. math

    how do you find which two consecutive whole #s the square root is between for 138

    asked by shamiya
  220. World Geography

    What current events have gone on in Switzerland since September? I only need one and it only has to be vague.

    asked by Lilly
  221. physics

    When the play button is pressed, a CD accelerates uniformly from rest to 495 rev/min in 3.1 revolutions. If the CD has a radius of 6 cm, and a mass of 17 g, what is the torque exerted on it?

    asked by marie
  222. statistics

    A group of adults of 200 aged 21 to 50 were selected from those entering Fit Right Health stores in Washington state, and were randomly divided into two groups. One group was given an herb and the othe placebo. After 6 months, the the number of respiratory

    asked by Patricia
  223. statistics

    a student took a 25 question true and false test answering the question randomly without reading them. If a score of 18 is correct is the minimum passing grade, how likely (calculate probability) is it that the random guesser will pass the test

    asked by karen
  224. Math

    Provide an example of at least five ordered pairs that do not model a function. The domain will be any five integers between 0 and 20. The range will be any five integers between -10 and 10. Why does your example not model a function?

    asked by Sha
  225. physics grade 12

    we have a trebuchet. if the arm of the trebuchet fires in a circular motion with a radius of 2.0 m and the mass is 50kg on the other end of the arm. what will the speed of the 4 kg boulder be as it is launched into the air? assuming it is launched parallel

    asked by s.r
  226. pre-calc please help!!

    an open box with a volume of 1500cm cubed is to be constructed by taking a piece of cardboard of 20 cm by 40 cm, cutting squares of sides length x cm from each corner and folding up the sides. show that this can be done in two ways, and find exact

    asked by steph
  227. physics grade 12

    we have a trebuchet. if the arm of the trebuchet fires in a circular motion with a radius of 2.0 m and the mass is 50kg on the other end of the arm. what will the speed of the 4 kg boulder be as it is launched into the air? assuming it is launched parallel

    asked by s.r
  228. Physics

    A block of mass m is being dragged across the floor by a force F. The coefficient of friction between the block and floor is u. Show that if the block is being accelerated by the force F from rest for a time t, the speed of the block at time t can be found

    asked by Courtney
  229. Heeelllppp in chemistry plzzzz

    the reaction BrO3- + 3SO3 2- ---> has the rate law r= k[BrO3-][SO3 2-]. what is the order of the reaction with the respect to each reactant? wat s the overall order of the reaction?

    asked by Tarkan
  230. pre-calc

    area of a rectangular region: a farmer wishes to create two rectangular regions bordering a river, by three fences perpendicular to the river and one connecting them. suppose that x represents the length of each of the three parallel pieces of fencing. she

    asked by steph
  231. Please proofread my essay and make corrections

    Public schools vs. Private schools Private and public schools education differs in many ways, there are many difference of both types of schools such as their academic reputation, class sizes and admissions requirements. Student’s performance in public

    asked by ME
  232. math

    rectangular roof of hospital has width of 80ft, and area of 16,000sq ft. what is length and perimeter of roof

    asked by jennifer
  233. science

    at what distance is an astronaut exactly half his or her weight?

    asked by science guy
  234. Pre-Vet

    I just need to be sure that my personal explanation, from hands on research with sharks, of what causes tonic immobility makes sense. What I found is that the only stimuli needed to induce tonic immobility on sharks, rays, and skates is slight compression

    asked by Harley
  235. science

    how much less is the gravity on the lunar surface than on earth?

    asked by jake
  236. science

    what would the astronauts mass be on the lunar surface?

    asked by jake
  237. science

    what would the astronauts weight be on the lunar surface?

    asked by jake
  238. Physics

    How long will it take a 1830 W motor to lift a 285 kg piano to a sixth-story window 16.0 m above?

    asked by Kristy
  239. Calculus

    Given the function defined as f(x)=x^3-(3/2)x^2-6x+10 a) Explain why f(x) must have a root between x=-3 and x=-2 b) Write an equation of the line perpendicular to the graph of f at x=0 c) Find the x and y coordinates of the point on the graph of f where

    asked by Kara
  240. Stats

    You will need to examine two of the nine sections of data: one section of qualitative data (choose either Gender or Position) one section of quantitative data (choose either Intrinsic or Extrinsic) Each section should include all data points listed in the

    asked by Puppygirl
  241. Calculus

    Given the function defined as f(x)=x^3-(3/2)x^2-6x+10 a) Explain why f(x) must have a root between x=-3 and x=-2 b) Write an equation of the line perpendicular to the graph of f at x=0 c) Find the x and y coordinates of the point on the graph of f where

    asked by Kara
  242. Math

    Your friend states that your mortgage is "an annuity where you are the bank."What does she mean?

    asked by Hannah
  243. math

    Interest is calculated with the following formula I=Prt What is the future value ( present value + interrst ) of this account? Present value is $600; interest is 6% Term is 12 years ( Enter your answer as dollars and cents. )

    asked by brandon
  244. math

    What is 10 +10 and 10*10 and what is the difference

    asked by Anonymous
  245. ecology

    Give specific examples of at least two (2) production and two (2) consumption habits humans have related to material resources Join Now For Free

    asked by Anonymous
  246. calculus

    Question 1 The figure below shows the rate of change of the quantity of water in a water tower, in liters per day, during the month of April. If the tower had liters of water in it on April 1, estimate the quantity of water in the tower on April . Round

    asked by megan
  247. Regression analysis

    1) Salary levels are determined by a number of important factors such as the years of experience, education level, job classification, etc. Other factors that contribute to salary levels might be due to gender or racial discrimination. Discuss how a

    asked by joel
  248. Operations Management

    Suppose the company has revised its plans for the processes described in part “a” to accommodate technological process changes. Determine the placement of departments that will now minimize total travel cost. Use the distances shown in part “a”,

    asked by kim