Questions Asked on
October 29, 2011

  1. Physics (7)

    A 12-g bullet moving horizontally strikes and remains in a 3.0-kg block initially at rest on the edge of a table. The block, which is initially 80 cm above the floor, strikes the floor a horizontal distance of 120 cm from its initial position. What was the

    asked by Anonymous
  2. Calculus

    The number N of US cellular phone subscribers (in millions) is shown in the table. (Midyear estimates are given.) t 1996 1998 2000 2002 2004 2006 N 44 69 109 141 182 233 (a) Find the average rate of cell phone growth between the following years. In each

    asked by Christina
  3. physics

    An Olympic skier moving at 20.0 m/s down a 30.0 degree slope encounters a region of wet snow and slides 145 m before coming to a halt. What is the coefficient of friction between the skis and the snow?

    asked by Victoria
  4. English

    Whitman's poetry reflects a romantic view of nature. A.True B. False

    asked by Glen
  5. mRNA

    sometimes a mistake occurs in the stranslation of an mRNA strand. Suppose that the reading of the mRNA stand ATGCCCGCTATCCGACGATAA began, by mistake, at the second nucleotide instead of the the first . Write the sequence ot amino acids that would be formed

    asked by Nghia
  6. Chemistry

    Calculate the molarity of a solution if 300.0 mL of it contains 16.8 g of KNO3. [Use formula weight: KNO3, 101.11 amu]....Question do I need to convert 300.0 mL to L? My initial set up looks like this: (16.8g/101.11amu)/300.0 mL my answer turns out to be

    asked by Chemistry Chick
  7. Calculus (Derivatives)

    A tray of lasagna comes out of the oven at 200°F and is placed on a table where the surrounding room temperature is 70°F. The temperature T (in °F) of the lasagna is given by the function T(t) = e^(4.86753 - t) + 70, where t is time (in hours)after

    asked by Mishaka
  8. physics please help!!

    In the design of a supermarket, there are to be several ramps connecting different parts of the store. Customers will have to push grocery carts up the ramps and it is obviously desirable that this not be too difficult. The engineer has done a survey and

    asked by archi
  9. chemistry

    Calculate the osmotic pressure of a 6.0 × 10-2 M solution of NaCl at 20°C (293 K).

    asked by Chemistry Chick
  10. physics

    A person holds a 1.42N baseball in his hand, a distance of 34.0cm from the elbow joint, as shown in the figure . The biceps, attached at a distance of 2.75cm from the elbow, exerts an upward force of 12.6N on the forearm. Consider the forearm and hand to

    asked by B
  11. chemistry

    If 5.20 g of HCl is added to enough distilled water to form 3.00 L of solution, what is the molarity of the solution? [Use molecular weight: HCl, 36.46 amu]

    asked by Chemistry Chick
  12. Calculus (Derivatives)

    Two particles are moving in straight lines. The displacement (in meters) of particle 1 is given by the function e^(4cos(t)) , where t is in seconds. The displacement (in meters) of particle 2 is given by the function -(t^3)/(3) - (t^2)/(2) + 2 , where t is

    asked by Mishaka
  13. Chemistry

    Calculate the osmotic pressure of a 6.0 × 10-2 M solution of NaCl at 20°C (293 K). Okay when I set up problem MRT....I get something totally different from the answer 2.9 atm. Could u please show me your set up to get to 2.9 atm? Thanks a billion!!

    asked by Chemistry Chick
  14. Physics (6)

    A 10-g bullet moving 1000 m/s strikes and passes through a 2.0-kg block initially at rest, as shown. The bullet emerges from the block with a speed of 400 m/s. To what maximum height will the block rise above its initial position?

    asked by Anonymous
  15. accounting

    Finishing Touches has two classes of stock authorized: 8%, $10 par preferred and $1 par value common. The following transactions affect stockholders' equity during 2010, its first year of operations: January 2 Issue 100,000 shares of common stock for $25

    asked by siyao
  16. ELECTRICITY AND MAGNETISM

    a dust particle with mass =5.0*10-9 kg and charge q =2.0nC starts from rest at point a and moves in a straight line from a to the point b ! what is its speed V at point b? please some on SOLVE it and send me ON my emial after got solved pleaseee ?

    asked by sufyan khalil
  17. Physics (4)

    A 4.0-kg particle is moving horizontally with a speed of 5.0 m/s when it strikes a vertical wall. The particle rebounds with a speed of 3.0 m/s. What is the magnitude of the impulse delivered to the particle?

    asked by Anonymous
  18. math (calculus)

    A rectangular sheet of paper of width a and length b, where 0

    asked by Kelsey
  19. Chemistry

    Calculate the osmolarity of a 2.0 × 10-3 M Na3PO4 solution. Na3PO4 is an ionic compound and produces an electrolytic solution.

    asked by Chemistry Chick
  20. matlab

    One bank pays 5.5 percent annual interest, while a second bank pays 4.5 percent annual interest. Determine how much longer it will take to accumulate at least $50 000 in the second bank account if you deposit $1000 initially and $1000 at the end of each

    asked by sean
  21. statistics

    In a sample of 100 steel wires the average breaking strength is 50 kN, with a standard deviation of 2 kN. a. Find a 95% confidence interval for the mean breaking strength of this type of wire. b. An engineer claims that the mean breaking strength is

    asked by Don't get it!! :(
  22. chemistry

    a student set up a reaction with 0.2905g of cholesterol and 0.13g of nonanoyl chloride in excess triethylamine, and collected 0.0244g of solid product. what is the actual yield (in grams) of cholesteryl nonanoate? explain how to do this please :)

    asked by anna
  23. Physics (5)

    A 2.0-kg object moving 5.0 m/s collides with and sticks to an 8.0-kg object initially at rest. Determine the kinetic energy lost by the system as a result of this collision.

    asked by Anonymous
  24. 10th grade math

    a rectangular picture 8 inches by 12 inches has a frame of uniform width x inches. Write a function expressing the total area A of the picture and the frame as a function of x.

    asked by Stephanie
  25. Trigonometry

    Write as an algebraic expression in u. Tan(cos^-1 u)

    asked by ALISON
  26. Science

    What would happen if ozone were to disappear from the upper atmosphere? From the lower atmosphere? Would we die if it disappeared completely?

    asked by Shirley
  27. math

    1. Two children balance a see-saw in horizontal equilibrium. One weighs 80 lb. and the other weighs 60 lb. and is sitting 4ft. from the fulcrum. Find the force the fulcrum applies to the beam and the distance to the fulcrum to the 80 lb. child. (Neglect

    asked by gaurav
  28. ART ( please help)

    i have been working one this paper for a few days and i have been struggling with it, I need to write about the elements and principles of the art piece "Polly, Minou and Eon" by Will Barnet. I cannot seem to figure out any of the elements and principles

    asked by Mandy
  29. Physics

    Hello, I'm trying to figure out which of the following statements are TRUE. I suspect that 2, 6, 8 are true...and that there is one more that is true, but not sure which one? Thanks! It is impossible to have a collision between two objects in which the

    asked by Anonymous
  30. Math - more help please

    A thermometer reading 7 degrees C is brought into a room with a constant temperature of 29 degrees C. If the thermometer reads 15 degrees C after 4 minutes, what will it read in 6 minutes? 11 minutes? So I guess I need to put into newton's law of cooling:

    asked by Sushmitha
  31. mathematics

    What is the solution for this? The surface area of a sphere varies in direct proportion to the square of its radius. If a sphere of radius 6cm has a surface area of 452 square cm, find, to the nearest mm, the radius of a spherewith the surface area 1000

    asked by Richelle
  32. chemistry

    Calculate the concentration (% W/V) of NaCl solution that was made by dissolving 15.0 g of sodium chloride in enough water to make 300.0 mL of solution.

    asked by Chemistry Chick
  33. math

    1. Two children balance a see-saw in horizontal equilibrium. One weighs 80 lb. and the other weighs 60 lb. and is sitting 4ft. from the fulcrum. Find the force the fulcrum applies to the beam and the distance to the fulcrum to the 80 lb. child. (Neglect

    asked by gaurav
  34. algebra

    How many years and days will it take for a deposit of $700 to double at 4% interest compounded continuously?

    asked by BJ
  35. math

    1. Two children balance a see-saw in horizontal equilibrium. One weighs 80 lb. and the other weighs 60 lb. and is sitting 4ft. from the fulcrum. Find the force the fulcrum applies to the beam and the distance to the fulcrum to the 80 lb. child. (Neglect

    asked by rahul
  36. chemistry

    Consider a neutral atom with 30 protons and 34 neutrons. The mass number for this atom is

    asked by Anonymous
  37. Physics

    A 1200-kg roller coaster car is initially at the top of a rise, at point circle a. It then moves 145 ft, at an angle of 40.0° below the horizontal, to a lower point circle b. (a) Choose the car at point circle b to be the zero configuration for

    asked by Anonymous
  38. Chemistry

    Calculate the concentration (% W/V) of NaCl solution that was made by dissolving 15.0 g of sodium chloride in enough water to make 300.0 mL of solution. Okay the answer is 5.00%....however I keep getting 0.0500%....Why? and which one is the correct answer?

    asked by Chemistry Chick
  39. geometry

    ray xy bisects angle axb?

    asked by Sarah
  40. Physics (3)

    An explosion in a rigid pipe shoots out three pieces. A 6 g piece comes out the right end. A 4 g piece comes out the left end with twice the speed of the 6 g piece. From which end does the third piece emerge? A. B. C Right end Left end Not enough

    asked by Anonymous
  41. Biology

    the biome with the fewest seasonal changes is?

    asked by Randy
  42. algebra - help please

    A thermometer reading 7 degrees C is brought into a room with a constant temperature of 29 degrees C. If the thermometer reads 15 degrees C after 4 minutes, what will it read in 6 minutes? 11 minutes? So I guess I need to put into newton's law of cooling:

    asked by Sushmitha
  43. math

    A thermometer reading 7 degrees C is brought into a room with a constant temperature of 29 degrees C. If the thermometer reads 15 degrees C after 4 minutes, what will it read in 6 minutes? 11 minutes?

    asked by Sushmitha
  44. Physics (1)

    A 4.1 kg rifle is suspended by strings and fires a 0.0030 kg bullet at a speed of 1500 m/s. What is its recoil speed in m/s?

    asked by Anonymous
  45. physics

    Find the linear speed of the bottom of a test tube in a centrifuge if the centripetal acceleration there is 5.4×104 times the acceleration of gravity. The distance from the axis of rotation to the bottom of the test tube is 7.9cm.

    asked by Anonymous
  46. Pre Calculus

    using the factor theorem to show that x-c is a factor of P(X) for the given values of c, and factor 1. P(x)=x3-5x^2+8x-4; c=1

    asked by Josh
  47. Grammar

    Select the sentence which is correctly punctuated, spaced, and capitalized. 1. A) The twins were a lot alike; they both ate too much. B) The twins were a lot alike: they both ate too much. C) The twins were a lot alike - they both ate too much. My answer

    asked by Cindy
  48. Physics (2)

    The two particles are both moving to the right. Particle 1 catches up with particle 2 and collides with it. The particles stick together and continue on with velocity vf. Which of these statements is true? A. vf=v2. B. vf is less than v2. C. vf is greater

    asked by Anonymous
  49. speech

    I am doing a speech on how to decorate a cupcake. But.. i do not know how to start it. I need an attention grabber any ideas?

    asked by rachel
  50. Algebra 1

    Can anyone help me with this two-step equation: 10=0.3x-9.1

    asked by Isabella
  51. American History

    Which is most accurate regarding the American political climate between 1876 and 1896? A. The influence of the president over Congress diminished? B. The party that won the presidential election also controlled Congress? C. Southern states tended to vote

    asked by Ginger
  52. English

    Hi, I'm having trouble understanding this and relating it back to my area of study, "belonging"- "In this regard, Emily !@#$%^&inson's poetry repeatedly echoes Voegelin's analyses of consciousness and existence. For Emily !@#$%^&inson, to be hman is to BE

    asked by Adriana
  53. MATH HELP PLEASE

    The slash (/) line represents that the number is a fraction. divide: sqrt45 / sqrt81 = simplify: 7sqrt3 / sqrt5 = Multiply: sqrt7/sqrt8 X sqrt24/sqrt49 = Thanks for the advice regarding how to show square root symbol correctly. Also thank for taking the

    asked by TO: drwls
  54. Chemistry

    1000 g of a 50% (mass percentage) nitric acid solution is to be diluted to 20%(mass percentage) nitric acid solution. How many liters of water should be added to the starting solution? Please show me the detail answer

    asked by Dewa
  55. Chemistry

    1000 g of a 50% (mass percentage) nitric acid solution is to be diluted to 20%(mass percentage) nitric acid solution. How many liters of water should be added to the starting solution? Please show me the detail answer

    asked by Dewa
  56. chemistry

    Consider a neutral atom with 30 protons and 34 neutrons. The mass number for this atom is

    asked by Anonymous
  57. Trig

    Find the measure of the central angle, in radians, given the area of the sector as 22.6 cm2 and a radius equal to 3.7 cm

    asked by Julianne
  58. chemistry

    You need to make an aqueous solution of 0.121 M magnesium chloride for an experiment in lab, using a 250 mL volumetric flask. How much solid magnesium chloride should you add ?

    asked by Linda
  59. Algebra

    One half of Heather's age two years from now plus one third of her age three years ago is twenty years. How old is she now? Let x= Heather's age now X must be a whole number that is positive.

    asked by Holly J.
  60. Math

    A seismograph 300 km from the epicenter of an earthquake recorded a maximum amplitude of 5.8 x10^2 µm. Find this earthquake's magnitude on the Richter scale.

    asked by Angel
  61. business

    is the trade-off between the necessity of writers, musicians, artists, and movie studios to profit from their work and the free flow of ideas for the public benefit. Movie (and music) industry participants claim that encryption programs are necessary to

    asked by Anonymous
  62. statistics

    Gallup News Service conducted a survey of 1,006 American adults aged 18 years or older, September 24-27, 2007. The respondents were asked, “What, if anything, worries you most about your personal financial situation in he long term? ‘Of the 1,006

    asked by zee
  63. science

    (a) at what times of year are the periods of daylight and darkness the same everywhere on the earth? What are these times called? (b) Where is the noon sun directly overhead at these times?

    asked by Shirley
  64. Math

    If KL=3cm,KM=7cm and LM=5cm.Calculate the angle K,M and the area of angle KLM

    asked by Somila mdunyelwa
  65. physics

    A 1.7 kg block is moved at constant speed over a surface for which the coefficient of kinetic friction is 0.27. The displacement is 2 m. It is pushed by a force directed at 25 degrees below the horizontal. Find the work done on the block by: the force. How

    asked by joe
  66. algebra 2

    you can make an open box from a piece of flat cardboard. First cut congruent squares from the four corners of the cardboard. Then fold and tape the sides. let x equal the side of each congruent squares as x increases so does the depth of the box the

    asked by herry
  67. college algebra

    Solve the following equation in the real number system. Please show all of your work. 2x^3-3x^2-14x+15=0

    asked by julez
  68. college allgebra

    f(x)=x^6+4x^5+4x^4+3x^3-x^2-5x+4 Find the maximum number of real zeros, and Use Descartes's rule of signs to determine how many positive and how many negative zeros the function has. You do not need to find the zeros.

    asked by julez
  69. Maths urgent help needed,

    1.Mr Sim bought new tv at a discounted price of 15%.He paid $836, inclusive of 3% GST(goods and services tax. What was the original price of the tv? 2.How to calculate original price before GST and before discount? What is the formula? Tks

    asked by joi
  70. college algebra

    Find the real and complex zeros of the following function. f(x)=x^3-3x^2+25x+29

    asked by julez
  71. math

    10x^2+5 y^2-2xy-28x-6y+41=0 and 3x^2-2y^2+5xy-17x-6y+20

    asked by mat
  72. physics

    is the following statements true or false + write a correct version of each false sentance below: 1. usually, the cooler a liquid or gas is, the denser it is. 2. if you only want a small volume of hot water, you should place the immersion heater near the

    asked by lissa
  73. Science

    What kind of carbon-carbon bonds are found in alkane molecules? Is the answer Pentane

    asked by Shirley
  74. English

    1) Writeacher, I need the help of a science teacher to find a theme high-school students (aged 16 and 17) can investigate with their German and French partners. Our students study biology (also bilotechnologies) , chemistry, and earth science. 2) Can you

    asked by Henry2
  75. physics

    Find the minimum diameter of a 51.5-m-long nylon string that will stretch no more than 1.01 cm when a load of 68.9 kg is suspended from its lower end. Assume that Ynylon = 3.51·108 N/m2

    asked by maria
  76. Science

    If a 150 pound man walks onto an elevator. Suddenly it rises rapidly from the 1st to 14th floor. if the man steps onto a scale in the elevator during the rapid rise, he would weigh... A) 150 pounds B) More than 150 pounds C) Less than 150 pounds Please

    asked by ABC123DOREMI
  77. science

    If a 150 pound man walks onto an elevator. Suddenly it rises rapidly from the 1st to 14th floor. if the man steps onto a scale in the elevator during the rapid rise, he would weigh... A) 150 pounds B) More than 150 pounds C) Less than 150 pounds Please

    asked by ABC123DOREMI
  78. help! physics

    A 1.7 kg block is moved at constant speed over a surface for which the coefficient of kinetic friction is 0.27. The displacement is 2 m. It is pushed by a force directed at 25 degrees below the horizontal. Find the work done on the block by: the force. How

    asked by joe
  79. Science

    The word equation for Iron and Sulphur

    asked by Daphne
  80. biology

    I really need help i am so confued !! use the crossover values given to calculate the sequence and the distance apart of the genes indicated P-m 7% K-m 28% P-K 21% m-C 5%

    asked by Poppy
  81. statistics

    80% of students passed a class. 90% of those 80% did homework. Of the 20% that didn't pass, 60% of them did the homework. What is the probability of a student having done the homework?

    asked by Danyell
  82. math

    2. One side of a right triangle is 12.5 ft. The perimeter is 38.7 ft. What is the length of the hypotenuse and the other unknown side?

    asked by gaurav
  83. health care

    What effects or potential effects do technologically based communication modalities—between patients and health care providers and between health care providers only—have on health care costs?

    asked by Anonymous
  84. college algebra

    Find the real and complex zeros of the following function. f(x)=x^3-3x^2+25x+29

    asked by julez
  85. college algebra

    Form a polynomial, f(x), with real coefficients having the given degree and zeros. Degree 3; zeros: 1 + i and -10

    asked by julez
  86. calculus

    let xy + x^2 = x find y'

    asked by redgy
  87. MATH 7th GRADE

    7ã3 / ã 5

    asked by PLEASE HELP
  88. physics

    Hello, I'm trying to figure out which of the following statements are TRUE. I suspect that 2, 6, 8 are true...and that there is one more that is true, but not sure which one? Thanks! It is impossible to have a collision between two objects in which the

    asked by John
  89. algebra - more help please

    A thermometer reading 7 degrees C is brought into a room with a constant temperature of 29 degrees C. If the thermometer reads 15 degrees C after 4 minutes, what will it read in 6 minutes? 11 minutes? So I guess I need to put into newton's law of cooling:

    asked by Sushmitha
  90. Calculus

    A 15 ft ladder leans against a wall. The bottom of the ladder is 4 ft from the wall at time t=0 and slides away from the wall at a rate of 3ft/sec. Find the velocity of the top of the ladder at time t=2. The velocity of ladder at time t=2 is

    asked by saud
  91. MATH MIDDLE SCHOOL

    The slash (/) line represents that the number is a fraction. divide: sqrt45 / sqrt81 = simplify: 7sqrt3 / sqrt5 = Multiply: sqrt7/sqrt8 X sqrt24/sqrt49 = Thanks for the advice regarding how to show square root symbol. Also thank for taking the time to help

    asked by PLEASE HELP
  92. Riddle HELP

    There are tree stoves. A glass stove, a brick stove, and a wood stove. You only have a match. Which do you light up first? Two cops walked into a room with no windows and found a dead man who obviously hung himself from the ceiling, though they couldn't

    asked by lizzy
  93. finance

    how long will it take to double my investment with 2500 at 4% annually

    asked by jessica
  94. Algebra 1

    Without solving the equation -3x+5=44, tell whether the value of x is positive or negative. How do you know?

    asked by Mercedez
  95. hvac

    when antifreeze is add to water the water specific heat

    asked by miguel
  96. engineering

    I am studying Fire Science Engineering. I have a question concerning my homework. The question is A compartment measures 3 meters by 5 meters and is 2.8 meters high. A fire raises the temperature from 20 degrees C to 1000 degrees C. If the starting

    asked by Deborah
  97. MATH

    Thanks for the answers but I must show the work for each problem. Can someone please help now that I finally submitted the square root correctly,thanks to drwls, and Ms. Sue. Thank you The slash (/) line represents that the number is a fraction. divide:

    asked by PLEASE HELP
  98. science

    If a 150 pound man walks onto an elevator. Suddenly it rises rapidly from the 1st to 14th floor. if the man steps onto a scale in the elevator during the rapid rise, he would weigh... A) 150 pounds B) More than 150 pounds C) Less than 150 pounds Please

    asked by ABC123DOREMI
  99. trig

    I'm confused with this concept: Okay, so I have this problem: cos2x( 2 cos+1)= 0 I understand I have to work the problems separately and I get cos x= 2 and cos x= 1/2 Now, what I don't understand is how this connects to pi, radians or the unit circle. If

    asked by Anonymous
  100. English

    I have a question and would appreciate any input or advice We just finished reading The Catcher in the Rye" and I'm stuck on a question for homework; Holden's anger over Stadlater dationg Jane, who symbolically guards her kings in a game of checkers shows

    asked by Mattie
  101. Physics

    A compartment measures 3.5 meters by 5.5 meters and is 3 meters high. A fire raises the temperature from 68 degrees F to 1500 degrees F. If the starting pressure was 1 atmosphere, what volume is present at the elevated temperature assuming the compartment

    asked by Deborah
  102. Honors chemistry

    What is the melting and boiling point of gold 16 carat

    asked by Anonymous
  103. General

    The more I read I'm getting confused. Just want to make sure. Winds that pass through an upper level trough go counter-clockwise in the Northern Hemi & clockwise in the Southern Hemi, right?? Thanks

    asked by Sue
  104. Honors chemistry

    how much is 100 grams of 16 carat gold?

    asked by Anonymous
  105. science

    Health and wellness

    asked by Anonymous
  106. graphing

    Can someone explain what quadrant this would be in and the domain and range. I have no idea how to graph it. G(x)= -3sin^-1 (2x)

    asked by ALISON
  107. chacking if i paraphrased correctly helppppppppppp

    I was wondering if I paraphrased correctly. The original article is:(my work is at the end ) Known as the "Napoleon of the women's rights movement," Susan B. Anthony was the co-founder (with Elizabeth Cady Stanton) of the National Woman Suffrage

    asked by Anonymous
  108. English

    I left out this short summary. I really hope you can check this, too. Thank you. 1) Elephants are afraid of coming up close and personal (a synonym?) with humans because they have always been heavily poached. 2) The author of the article writes that he

    asked by Henry2
  109. chemistry

    .46 gm of magnesium produces .7667 gm of magnesium oxide,.3 gm of magnesium liberates 280 ml of hydrogen at NTP from an acid and 1.26 gm of water is produce by combination of 1.12 gm of oxygen with hydrogen which law of chemical combination can be

    asked by salina
  110. MATH 8TH GRADE Correction

    Sorry I forgot to give directions for each problem. The lines represent that the numbers are fractions. Thank you. Multiply ã7/ã8 ~ ã24/ã49 = Divide ã45/ã81 = Simplify 7ã3/ã5 =

    asked by PLEASE HELP
  111. Economics

    Consider a perfect competitive market. Analyze in detail using graphical tools what would happen to the number of firms and firm profitability in short run and long run if demand for product falls and if it rises

    asked by Heather
  112. Math

    Which lists all the factors of a composite number? A) 1,3,9,27 B)1,9 C)1,2,3,4,12 D)1,11

    asked by Johnny
  113. Education 301

    I need to complete an assignment for edu 301 and I am completely lost. Can anyone help me get started? Create a flowchart, in which you create an organizational structure for the education system for the federal, state, district, and school levels. I have

    asked by Amanda
  114. geometry

    line AB is parallel to line CD, the measurement of angle A=2x-25, and the measurement of angle C=x+5. find the value of x. show work and explain your reasoning.

    asked by joseph
  115. Grammar

    Select the sentence which is correctly punctuated. 1.A) He has a 150-pack-year smoking history. B) He has a 150 pack year smoking history. My answer is A. 2.A) The gangrene had spread to one-half of his leg. B) The gangrene had spread to one half of his

    asked by Cindy
  116. English

    is there such a thing the "language" of percentages/surveys?

    asked by Nicole
  117. science

    What have the compounds in each of these pairs in common? How could you distinguish one from the other? (a) CH3COOH and CH3OH? (b) C2H5OH and H2O?

    asked by Shirley
  118. mgt/230

    describe how managers when applying a leadership principles can contribute to a healthy organizational culture.. don't get it I have been trying to find infomation but can't figure it out

    asked by at
  119. calculus

    Given that ∑(n=1 to inf) 1/(n^2) = (pi^2)/6, find the value of ∑(n=1 to inf) ((5n^2+6n+3)/((n^2)((1+n)^2))).

    asked by Anonymous
  120. calculus

    f(x)=cos(1/x) Find a sequence for x-values that approach 0 such that cos(1/x)=0.

    asked by Emily
  121. business

    •Discuss the pros and cons of the following statement: “ Egalitarian companies are more innovative•Identify three organizations that you perceive as being innovative. ◦Identify the innovation and its impact upon each organization.

    asked by meya
  122. science

    (a) What is the name of weather systems centered about regions of low pressure? (b) In what direction do winds in the northern hemisphere spiral around such a region? (c) In the southern hemisphere?

    asked by Shirley
  123. Desert

    How are deflation hollows made? Could you also give me some more pictures of hoodoos (the landforms)?

    asked by Alexandra
  124. alberga

    3r-5s=-4 5r+3s=16 elimination method

    asked by Anonymous
  125. hvac

    an oil slinger is found in a reciprocating compressor employing what type of lubrication system

    asked by miguel
  126. Stats

    Consider the Avionic Manufacturing Company that wishes to meet a demand of 10 units per month by purchasing the items from a vendor with a lead time of three-quarters of a month. The item cost is $2.50 per unit, replenishment cost is $3.50 per order, and

    asked by Toby
  127. physical

    Discuss the pros and cons of the following statement: “ Egalitarian companies are more innovative•Identify three organizations that you perceive as being innovative. ◦Identify the innovation and its impact upon each organization.

    asked by meya
  128. Statistical significance (Chi squared)

    I just want to make sure what I'm calculating this right. The data I got for one time point are 6 and 23 I know the equation for chi^2 is Calculating Chi Squared - Catherine, Friday, October 28, 2011 at 8:15pm I did a biology experiment where I need to

    asked by Catherine
  129. Psychology

    Kevin hates his job, his girl friend dropped him, and he had a headache this morning from staying up too late eating hamburgers and drinking beer by himself. He has decided to initiate a new attack today and take control of his life.He will fin a new job,

    asked by Carol
  130. Chemistry

    Hi there - My labs and lectures aren't in synch at the moment so we are now doing a prelab that is asking for info I haven't been taught yet uggg... The prelab question I'm having trouble with is as follows: What is the volume at STP for 0.415 g of argon

    asked by Help
  131. double checking if i paraphrased correctly

    Hi, You guys helped me earlier in editing my paraphrasing paragraph(thanx allot. This is my final draft hope it's edited correctly now. Susan B. Anthony was arrested and fined for illegally voting in the 1872 presidential election. She refused to pay the

    asked by Anonymous
  132. epidemiology

    how does Healthy People address public health issues

    asked by Ann james
  133. social studies landforms

    could you refer me to a website that would give me an image of geographic images and defitnions of landforms

    asked by marko
  134. Calculating Chi Squared

    I did a biology experiment where I need to analyze the statistical significance of betweeen a data set. My experiment consisted of measuring the effects in photosynthesis and cellular respiration by exposing solutions with leaf discs to different light

    asked by Catherine
  135. calculus

    Let 4xy^3 - x^2y= 5x - 6 - x^3 where y is a differential of X. Find y' in terms of x and y. I get: y'= -4y^3 - 2xy + 3x^2 -5 / x^2 -12xy^2 My answer handout shows the answer as positive. Which should it be, neg. or pos.? Thanks

    asked by redgy
  136. Math

    25^-1+3(5^-1)^2 (4+8)^0-5^-2 (-1/2)^3+4^-3 (-3)^-1+4^0-6^-1

    asked by Dana
  137. math

    4. You have $55000 to invest, and two funds you would like to invest in. The You-Risk-It Fund yields 13% interest. The Extra-Dull Fund yields 7% interest. Because of the college financial aid implications, you don’t think you can afford to earn more than

    asked by gaurav
  138. English-Please help!

    I have a question and would appreciate any input or advice We just finished reading The Catcher in the Rye" and I'm stuck on a question for homework; Holden's anger over Stadlater dationg Jane, who symbolically guards her kings in a game of checkers shows

    asked by Mattie
  139. MATH

    Assume f(x) = x2 + 4. Find the functional value requested. f(-6) =

    asked by Anonymous
  140. physics

    A person pushes a 10.0 kg lawn mower at constant speed with a force of 70.0 N directed along the handle, which is at an angle of è = 46.0° to the horizontal

    asked by chuck
  141. chemistry

    difference between cations and anions

    asked by sanreeti
  142. college algebra

    Use the intermediate value theorem to determine whether the polynomial function has a zero in the given interval. f(x)=8x^5-4x^3-9x^2-9;[1,2]

    asked by julez
  143. college algebra

    Find the bounds on the real zeros of the following function. f(x)=x^5-5x^4+8x+2

    asked by julez
  144. maths

    what are all the mathethematical terms you need to include in your answer for a question based on circle theorums?

    asked by lissa
  145. QNT

    A sample of 100 students participate in a final exam. The mean score is 88 with a standard deviation of five (5). What is the standard error of the measurement of the mean?

    asked by Needs Help
  146. Written Analysis

    I still need help with my assignment. Please show me examples of short paragraphs on discrimination(modern day) and outlining how I plan to find resources and evaluate my resources for credibility.

    asked by Keri Ann
  147. English III

    ☢HELP☢ How is the alchemist by Paulo Coelho a fable? How is the alchemist by Paulo Coelho a fable? A parable? An allegory? I don't know know at all. The story is a nice read . . . but its very hard to decipher. I can't find any passages in the story

    asked by Cato
  148. MATH Confused

    How can I find the square root symbol to submit problems? Every time I choose the symbol that resembles the square root the actual format changes. When I sumbmit to you it looks like some crazy symbol. It makes the problems look totally different than they

    asked by PLEASE HELP
  149. Help

    Simplify by removing factor of 1 7z-49/7z I have the answer as -7 is this correct

    asked by Katie A
  150. quote a reference

    im writting a essay for child care how do i quote a reference from a book can you give an example

    asked by elizabeth
  151. Intro To college math

    Find the future value, using the future value formula and a calculator. (Give your answer to the nearest cent.) $42.31 at 4.5% compounded semiannually for 4 years.

    asked by Betty
  152. Physics

    A 5.30-ìC charge is moving with a speed of 9.30 x 104 m/s parallel to a very long, straight wire. The wire is 6.60 cm from the charge and carries a current of 87.0 A. Find the magnitude of the force on the charge.

    asked by Kristi
  153. science

    How could you distinguish one from the other? (a) CH3COOH and CH3OH? (b) C2H5OH and H2O?

    asked by Shirley
  154. Math - logs

    I need help solving this because it involves 2 bases: log (base 2) [log (base 5) 25]= ???

    asked by Anil
  155. chemistry

    what is delta H for the formation of 12.9 g of Aluminum Oxide with 2 aluminum oxides as the reactant

    asked by bailey
  156. hvac

    what happens to the pressure at locations moving vertically up or down a ph constant-enthalpy line?

    asked by miguel
  157. hvac

    gas trapped in a reciprocating piston compressors clearance space expands at the beginning of the suction stroke what effect does this have on the system

    asked by miguel
  158. hvac

    compressor cylinger unloading reduces the capacity of a reciprocating compressor by

    asked by miguel
  159. statistics

    Suppose we have a population of scores with a mean (μ) of 200 and a standard deviation (σ) of 10. Assume that the distribution is normal. Provide answers to the following questions: What score would cut off the top 5 percent of scores? What score would

    asked by lori
  160. Math

    If KL=3cm,KM=7cm andLM=5cm

    asked by Somila mdunyelwa
  161. xmgt216

    what are the key control mechanisms? cause im supposed to identify some of the key control mechanisms and describe how management can aooly them to aid in achieving organizational goals?

    asked by at
  162. Ratio and proportion

    About 9 out of 10 adults think it is a good idea to exercise regularly. But the ones who think it is a good idea, only 1 in 6 actually exercises at least 3 times a week. At this rate, how many of the 300 employees in our company exercise regularly? What I

    asked by Alex L.
  163. college algebra

    list potential rational zeros f(x)=x^4+3x^2-4

    asked by julez
  164. chemistry

    Calculate the volume of 1.60 in milliliters that contains 6.00 of solute.

    asked by nancy
  165. Quantatative Analysis

    "what volume of .50 m h2so4 must be added to 65 ml of .20 m h2so4 to give a final solution of .35 M? assume volumes are additive"

    asked by Stumped
  166. English

    Should Americans compaines refuse to do business in countries that do not pratice democracy?

    asked by Colby
  167. stats

    a candidate receives 60% of the N votes in an election, where N is very large. Compute the probability that he leads after a count of the first 100 votes.

    asked by st
  168. history

    who was Naqia queen of Assyria?

    asked by lissa
  169. MATH 8TH GRADE

    ã7/ã8 ~ ã24/ã49 = ã45 / ã81 = 7ã3 / ã5 = The lines between the numbers represent the numbers as being fractions.

    asked by PLEASE HELP
  170. English

    work at start had been very strenuous.(turn into negative sentence)

    asked by pulak
  171. soc 120 intro to ethics&social responsibility

    Explore the challenges Goodman presents to relativism?

    asked by stanley
  172. Help Please

    Q+ 5/Q=-6 Help me solve plese

    asked by Katie A
  173. chemistry

    Hi everyone, Why are metals more reactive in acids? Thanks

    asked by jane
  174. physics

    Using a spring gun, a 4.0-kg steel block is launched up a lubricated ramp made out of steel. The angle of the ramp was measured to be 38.8º. The inital speed of the block was 12.0 m/s. (a) Determine the vertical height that the block reaches above its

    asked by Jamila
  175. Physics

    A 5.30-ìC charge is moving with a speed of 9.30 x 104 m/s parallel to a very long, straight wire. The wire is 6.60 cm from the charge and carries a current of 87.0 A. Find the magnitude of the force on the charge.

    asked by Kristi
  176. business

    What are the disadvantages of using a contingent work force?

    asked by Paul