Questions Asked on
June 10, 2011

  1. Science

    I need to make an acrostic poem for science. My teacher said that each letter needs to start a sentence about plant life. The word is photosynthesis. I need some ideas by the 13th of June. I already have p-h-o-t of photosynthesis. Pls help me!

    asked by Hanna
  2. science(physics)

    a force f= 3i+cj+2k acting on a particle causes displacement , d=-4i+2j+3k. If the work done is 6 joule then the value of c. Plz. Solve

    asked by marley
  3. writing

    The cost of new homes is high today. Many people are purchasing older homes in need of renovation. the most effective combination of sentences 1 and 2 would include which of the following groups of words? 1) although many homes need renovation 2)although

    asked by Ruth
  4. writing

    Still, do-it-yourself renovations is usually a source of pride for new homeowners, no matter how hard or how frustrating. what correction should be made to this sentence? 1)remove the comma after still 2)change is to are 3) change the spelling of usually

    asked by Ruth
  5. Physics

    A cylindrical copper cable 1.50Km long is connected across a 220.0V potential difference. (a) What should be its diameter so that it produces heat at a rate of 50.0W? (b) What is the electric field inside the cable under these conditions?

    asked by Rohan Khan
  6. Rohan Khan

    A person with body resistance between his hands of 10KÙ accidently grasps the terminal of a 14-KV power supply. (a) If the internal resistance of the power supply is 2000Ù, what is the current through the person’s body? (b) What is the power dissipated

    asked by Rohan Khan
  7. drawing

    21) The number of oil spills occurring off the Alaskan coast A) Discrete B) Continuous Find the odds. 22) When a single card is drawn from an ordinary 52-card deck, find the odds in favor of getting a red 10 or a black 6. A) 2: 25 B) 1 : 13 C) 1 : 25 D) 1

    asked by candy
  8. home school and community

    Describe three issues related to role confusion that a teacher may feel or may communicate.

    asked by sue
  9. statistics

    In a binomial distribution: A) the random variable X is continuous. B)the probability of event of interest (pie symbol)is stable from trail to trial C) the number of trials n must be at least 30 D) the results of one trial are dependent on the results of

    asked by Allen
  10. writing

    Doctors in the field of preventive medicine concentrate on "preventing disease and to encourage" good health practices. Best way to write the portion? 1) preventing disease and to encourage 2)prevent disease and to encourage 3)to prevent disease and to

    asked by Ruth
  11. Data Management

    A store manager believes that 42% of her customers are repeat business (have visited her store within the last two weeks). Assuming she is correct, what is the probability that out of the next 500 customers, between 200 and 250 customers are repeat

    asked by Babyboo
  12. Physics

    If a cylindrical space station 300 {\rm m} in diameter is to spin about its central axis, at how many revolutions per minute ({\rm rpm}) must it turn so that the outermost points have an acceleration equal to g?

    asked by Bronson
  13. writing

    They emphasized the importance of good maternal and child health care, including the administering of vaccines. what correction should be made to this sentence? 1) replace they with it 2) change emphasized to emphasize 3) change the spelling of importance

    asked by Ruth
  14. english 4

    Which is a positive connotation of the word inactive?

    asked by Anonymous
  15. math

    18. A farmer planted a field of BT 123 corn and wants to estimate the yield in terms of bushel per acres. He counts 22 ears in 1/100 of acres. He determines that each ear has 700 kernels on average. He also knows that a bushel contains about 90,000 kernels

    asked by Amanda
  16. writing

    Sentence 10: Finally, friends whom you haven't seen in years, long-lost relatives, and even mere acquaintances will begin calling in february to plan a lengthy visit with you in the summer. what correction should be made to this sentence? 1)change friends

    asked by Ruth
  17. geometry

    A rectangular prism has dimensions of x + 1, x - 1, and x. Write an expression for the total volume of the prism.

    asked by bruce
  18. accounting

    The Fast Delivery Service submitted the transactions given below. Analyze these business transactions. a. On October 1st, Joseph took $25,000 from personal savings and deposited the amount to open a business checking account in the name of Fast Delivery

    asked by mary
  19. Physics

    A parallel plate air capacitor of capacitance 245pF has a charge of magnitude 0.148ìC on each plate. The plates are 0.328mm apart. (a) What is the potential difference between the plates? (b) What is the area of each plate? (c) What is the electric field

    asked by Rohan Khan
  20. physics

    A charge Q is to be divided on two objects. What should be the values of the charges on the object so that the force between the objects can be maximum?

    asked by saradi
  21. college math

    cannot figure out the probability for the following: A pea plant i=must have exactly on of each of the following pairs of transis: Short(s) or tall(t); round(r) or wrinkled(w)seeds; yellow(y) or green(g)peas; and white(wh) or purple(p) flowers so A) How

    asked by Joyce
  22. Life orientation

    Two institution/community that are involved in supporting or giving redress to teenage pregnancy

    asked by Nadia
  23. Stats

    The wildlife department has been feeding a special food to rainbow trout fingerlings in a pond. A sample of the weights of 40 trout revealed that the mean weight is 402.7 grams and the standatd deviation 8alE8 gr. What is the probability that the mean

    asked by Brad
  24. art

    Jeff walls a sudden gust of wind (after Hokusai is a_______ that refers to a _____

    asked by Anonymous
  25. probability

    a bag contains red and blue marbles. with 10% more blue marbles than red. a)what is the probability of selecting 5 blue marbels ? b) Of selecting 2 reds and 3 blues ?

    asked by pedro1
  26. literature..

    in the crucible act 4, which reason does herrick give for drinking? a. it keeps him warm b. he is upset about the hangings c. he is thirsty d. he is afraid he will be condemned. am confused between a nd b ... plz aswer me nd briefly explain ur answer..

    asked by Anonymous
  27. statistics

    1. Draw a simple random sample of 15 students from your class, and calculate sample mean and sample variance of their heights(use Lottery method ) 2. Three blocks of Coal were analyzed by Four Chemists and the ash-content in the blocks was found to be as

    asked by sireesha
  28. TRIG..............

    Q.1 Prove the following identities:- (i) tan^3x/1+tan^2x + cot^3x/1+cot^2 = 1-2sin^x cos^x/sinx cosx (ii) (1+cotx+tanx)(sinx-cosx)/sec^3x-cosec^3x = sin^2xcos^2x.

    asked by MATHS
  29. calculus

    A plane is flying at 240mph and is climbing at 22 degrees. Find the rate at which it is gaining altitude when y=3miles

    asked by ron
  30. Chemistry

    What is the wavelength of the electromagnetic radiation emitted from a hydrogen atom when the electron undergoes the transition n = 5 to n = 3?((Broken Link Removed) is a spectrum m In what region of the spectrum does the line occur? near ultraviolet far

    asked by Lance
  31. Geometry

    HELP! Two Chords AB and CD, are equidistant from the center of a circle. AB=3x+7 and CD=27-x. Solve for x and find the lengths of AB and CD

    asked by Alex
  32. Chemestry

    The solubility product of copper(II) iodate, Cu(IO3)2, is 4 x 10-9 mol3 dm-9 at 25 °C. What is the solubility of copper(II) iodate in g dm-3? A 1.85 × 10-2 B 4.14 × 10-1 C 5.21 × 10-1 D 6.56 × 10

    asked by John
  33. Class 12th Calculus

    If y = e^x cosx, prove that dy/dx sqrt(2) e^x . cos(x+ pie/4)

    asked by Akash
  34. organic chemistry

    I need help with a lab report on extraction of iodine by dichloromethane, please help!

    asked by Delia
  35. Algebra II

    1.)P(-15/17,-8/17) is found on the unit crcle. find sin0 and cos0. 2.)solve: x=Arc tan(-sq root3). 3.)find sec0 if sin0=-4/5 and 270 degrees

    asked by Liddy
  36. AYUDA

    a bungee jumper whit mass 65. kg jumps from a high bridge. after reaching his lowest point. he oscillates ud a down, hitting a low point eight more times in 38.0 s. he finally comes to rest 25.0 m below the level of the bridge. calculate the spring

    asked by Diego
  37. algebra math

    what expression represents the area of the base of the box

    asked by rowena
  38. english

    During the 1980s El Salvador faced a multiyear civil war battle fighting against guerillas who were trying to destroy the economy and instill fear in its residents. These guerillas fought to create a Marxist regime. Their approach resulted in thousands

    asked by Anonymous
  39. College Math

    2008 (2nd)Course2-4.1 We are to find a function f(x) such that its derivative is x^2+x-1 and the graph of y=f(x) is tangent to the straight line y=x+1. First we find the coordinates of the point at which y=f(x) and y=x+1 are tangent.Since the slope of the

    asked by Bayarbold
  40. art history

    two kinds of shapes when an object is placed in a picture plane area are called

    asked by Anonymous
  41. Grammar

    ***Is this correct? Review the four paragraphs below. There is one paragraph matching each of the following types: summary, analysis, synthesis, and evaluation. Once you have read each paragraph, complete the following chart to identify the type of

    asked by Angelina
  42. Cultural Diversity

    Since the Hernandez family has experienced discrimination, hardship, and recent bullying in their neighborhood, Mr. Hernandez has enrolled his sons in the YMCA martial arts class. He would consider this action proper on the basis of the need to defend the:

    asked by Anonymous
  43. English

    1. Can you get me a a coke? 2. Can you bring me a coke? 3. Can you fetch me a coke? 4. Can you buy me a coke? (What does #1 mean, #2, 3 or 4?)

    asked by rfvv
  44. algebra

    If y is inversely proportional to x, and y=8 when x=2, find y when x=5

    asked by Mindy
  45. Chm

    8.08g of KNO3 were required to saturate 25g of distilled water at 20oC. Calculate the solubility of the solute in a) g/dm^3 of water b) mol/dm^3 of water

    asked by Ife
  46. mATH ANSWERS

    1) If the odds in favor of an event A are 3 to 1, what is the probability associated with event A occurring? A) B) C) 4 D) Determine whether the situation calls for a discrete or continuous random variable. 2) The height of a randomly selected student. A)

    asked by KEL
  47. Geometry

    How many rotations would a 17 inch diameter tire complete in one mile?

    asked by Shay
  48. Statistics

    What does the scope of the graph refer to?

    asked by Angel
  49. Geometry

    How tall would a glass (in the shape of a right circular cylinder) with a diameter of 3 inches need to be to hold 12 oz?

    asked by Shay
  50. accounting

    I got this of this web site but I don't understand where it all goes. this is the one I am working on. I need help. Part 1 BULLSEYE RANGES For Year Ended December 31, 2005 Unadjusted Trial Balance Adjustments Adjusted Trial Balance Account Title Dr. Cr.

    asked by shawna
  51. A and P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???): !!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG??? What is its mRNA nucleotide sequence? Indicate the product of this DNA segment/gene. What is the product’s

    asked by Sonya
  52. fractions

    fraction word problem. please advise on how to work the problem Phillip and Jane had a pie each. Phippip ate 1/4 of his and Jane ate more of the pie than Phillip. Which fraction of his pie could Jane have eaten. Possible answers: 2/5 1/6 2/8 or 1/8 Please

    asked by Suzanne
  53. geometry

    B is the midpoint of. AB=5x+2 AC=12x-2 What is the value of BC?

    asked by Antonisha
  54. accounting

    How do I figure FUTA/SUTA earnings? This is what my book gives: James Company has three employees .Its payroll information is given below. Employee Earnings Prior October to October Earnings Donald Robinson: $6050 $1200 OASDI Earnings FUTA/SUTA Earnings

    asked by Nick
  55. Grammar

    ***I know that the identifying is correct just need to make sure the final paragraph is grammatically correct and makes since. Review the four paragraphs below. There is one paragraph matching each of the following types: summary, analysis, synthesis, and

    asked by Angelina
  56. MATH-direct variation

    Which of the following represents a direct variation function? The answer coices are A)d=2r B)y=9x+1 C)y=-3 D)a=1/2h(b1+b2)

    asked by chelsea
  57. biology

    difference between gaseous exchange, respiration and breathing

    asked by sam
  58. sociology

    The souls of black folk, was this essay optimistic or pessimistic about future of US race relation?

    asked by Anonymous
  59. accounting

    Preparing closing entries and a post-closing trial balance for Exercise E4-3 I need help with this

    asked by shawna
  60. science(physics)

    vector a+ vector b= 2i Vector a+ vector b=4j Then the angle between vector a and vector b is ? Plz.solve

    asked by marley
  61. math

    x2 + 12x - 64 = 0

    asked by CC
  62. statistics

    What is the probability that the value of a randomly selected variable from a normal distribution will be more than 3 standard deviations from its mean value?

    asked by MrsAwhite
  63. English

    1. I found intetest in Harry Potter. 2. I found an intetest in Harry Potter. 3. I found intetests in Harry Potter. 4. I got interested in Harry Potter. 5. I got interest in Harry Potter. 6. I became interesed in Harry Potter. 7. I got an interest in Harry

    asked by rfvv
  64. English

    1. She made us clean the hall. 2. We saw him dancing in the hall. (What does 'hall' mean in each sentence, a building, a big room or a hallway?)

    asked by rfvv
  65. Physics

    The displacement of a linear damped oscillator is given, for weak damping by x=Ke^(-bΩt) sin⁡(βt+ ε) Show x has a maximum at times given by βt = 2nπ + d where n is an integer and d is gives the position of the first maximum Show also that the ratio

    asked by Bob
  66. algebra math

    mandy used a square card board to make an open box by cutting small squares from its corners and then bending the sides.The lenght of the side of the the card board used 60cm.question How would you represent the lenght of the sideof the box formed

    asked by rowena
  67. algebra math

    please help to answer this question how would u find the area of the base of the box

    asked by rowena
  68. 8th grade Math

    " four less than twice a number is greater than six " Can someone please write that as an expression ?

    asked by Maria
  69. Physics

    Hot air rises and cold air sinks. So in which condition will a switch of a fan heater be open or close ? Thanks (:

    asked by Janice
  70. 8th grade math

    A 20 ounce bag of popcorn costs $2.80 at the movie theater, if the unit price remains the same, how much would a 35 ounce bag cost ? Please help me, I'm in math class and Im stuck.

    asked by Kelly
  71. Math

    2004 (2nd) course2-3.2 Let P and Q be points on the line y=x+4 where the x-coordinates of P and Q are p and p+1,respectively.Let O denote the origin. (1)For 2 vectors OP(vector)and OQ(vector),the inner product OP(vector)*OQ(vector) takes its minimum when p

    asked by Bayarbold
  72. math

    A five acre lot is 660 feet long, how many feet wide is it?

    asked by Sharon
  73. accounting

    I need to add the last question I entered was for Showers Company

    asked by shawna
  74. algebra

    can you write an equation for the line with slope 2/3 and y-intercept 5?

    asked by mathew
  75. geometry

    If you make a glass in the shape of a right circular cone (think martini glass) how wide would the glass be if it is 4 inches tall and again holds 12 oz. Does not specify what the 12 oz are

    asked by Shay
  76. Class 12th Calculus

    If y= (x-1)log(x-1)-(x+1)log(x+1), prove that dy/dx = log(x-1/1+x)

    asked by Akash
  77. hum/176

    How Might You Determine If InformatiOn Found Online Is Trustworthy Describe Credibility Issues With InformatiOn Found On The Internet Essays and Term Papers

    asked by jackie
  78. Marketing

    How do we incorporate social and cultural forces in marketing systems?

    asked by Daniel
  79. English

    1. He vomited all the cookies he had eaten. 2. He vomited all the cookies he ate. 3. She was not so beautiful as I had imagined. 4. She was not so beautiful as I imagined. (Which ones are correct? Do we have to use the past tense or the past participle

    asked by rfvv
  80. Ethics

    I am so tired of seemingly educated students not knowing how to form complete sentences or spell. If you really want to make an impression, or even get anyone to read the posts, take the time to act like someone who's opinion is something we want to

    asked by Pat
  81. science

    Q.1 different between acid and bases. Q.2 Define Olfactory indicators.

    asked by roushan
  82. MATHS......

    solve the following. 1) x^3+3y^3+x+2y

    asked by MATHS
  83. science

    what happen to the depth of the pond when a stone covered with ice is thrown in the pond

    asked by prakriti
  84. Grammar

    ***Is this correct? Review the four paragraphs below. There is one paragraph matching each of the following types: summary, analysis, synthesis, and evaluation. Once you have read each paragraph, complete the following chart to identify the type of

    asked by Angelina
  85. Product of Terms [ 9th Grade]

    Whats the product of terms for (4a^2c^4)(3b^4c) ? ^ = exponenets.

    asked by Sahud
  86. science

    what are the arrangement and motions of molecules of substances in the solid phase, liquid phase, and gaseous phase?

    asked by harold
  87. computers

    Write a 300- to 400-word paper that describes the distinctions of data and information and briefly explains the process a computer uses to convert data into information.

    asked by Anonymous
  88. algebra

    How do I write this number in scientific notation 1. 8.68x10^1 2.1,900,000

    asked by kate
  89. english

    What would be the simple subject of the following sentences? Justin and Sara like to go hiking in the Rocky Mountains? This is the strangest looking tree I've ever seen! While hiding her anger as well as she could, Cindy handed the gift back to Bill. Our

    asked by Amanda
  90. math

    A fair number cube is rolled twice. W aht is the probbability that the first roll will be even and the second roll will be odd number?

    asked by zina
  91. 1/2 cup fraction word problem

    Jane is using a recipe to bake cookies.Recipe calls fo a little less than 1/2 of choc chips. Which amount is less than 1/2? 4/8 2/3 4/7 3/7 off the top of my head I see that 4/8 is equal should I use ldc and make 2/3 4/6 4/7 8/14 3/7 6/14 then what??

    asked by Suzanne
  92. Grammar

    ***I know the identifying is done correctly I just need to know if the paragraph is grammatically correct and makes since. ***Sorry that it was so long I hope this is better. Review the four paragraphs below. There is one paragraph matching each of the

    asked by Angelina
  93. Math

    x2 - 2x - 13 = 0

    asked by CC
  94. Math

    x2 - 2x - 13 = 0

    asked by CC
  95. STATISTICA

    . The first class in a relative frequency table is 50–59 and the corresponding relative frequency is 0.2. What does the 0.2 value indicate?

    asked by Anonymous
  96. math

    If a stone is tossed from the top of a 330 meter building, the height of the stone as a function of time is given by h(t) = -9.8t2 – 10t + 330, where t is in seconds, and height is in meters. After how many seconds will the stone hit the ground? Round to

    asked by Sam
  97. algebra math

    how would you find the area of the base of the box

    asked by rowena
  98. geometry

    Question: 2 of 40: Which of the following circle equations represents a circle whose center is at (0, 0)?Select one of the options below as your answer: A. x2 + y2 = 45 B. (x − 3)2 + (y − 5)2 = 0 C. (x + 3)2 + (y − 3)2 = 0 D. x2 + (y − 1)2 = 1

    asked by kieara
  99. Math

    The equation of the parabola which contains 2 points (1,1) and (-2,-2) and whose tangent at the point (1,1) has the slope k is y=1/3(A)x^2+1/3(B)-2/3(C). Express A,B and C with k .please solve this problem

    asked by Bayarbold
  100. science

    what is the power dissipated by a 10 ohm resistor through which a 2 ampere current is flowing?

    asked by harold
  101. math

    in the question 4x-(3-x) =7(x-3) =10 why r u not counting 4x3 as -12? israel

    asked by israel
  102. central

    the only property listed that is not characteristic of ionic compounds is

    asked by fatou
  103. math

    what is the range of 11 and 28

    asked by Anonymous
  104. science(physics)

    given vectors , Vector a= 2i + 3j, then the angle between vector a and y axis is? Plz solve

    asked by marley
  105. English

    1. I will give my parents the flower. 2. I will give my parents it. 3. Make two flowers and give each of your parents one flower. 4. Make two flowers and give each of your parents one. (Are #2 and #4 grammatically correct?)

    asked by rfvv