Questions Asked on
June 7, 2011

  1. Chemistry

    A sample of ethanol, C2H5OH, weighing 2.84 g was burned in an excess of oxygen in a bomb calorimeter. The temperature of the calorimeter rose from 25.00°C to 33.73°C. If the heat capacity of the calorimeter and contents was 9.63 kJ/°C, what is the value

    asked by Lance
  2. Chemistry

    Propane, C3H8, is a common fuel gas. Use the following to calculate the grams of propane you would need to provide 383 kJ of heat. C3H8(g) + 5 O2(g) → 3 CO2(g) + 4 H2O(g) ΔH = −2043 kJ

    asked by Lance
  3. Chemistry

    2. An object will sink in a liquid if the density of the object is greater than that of the liquid. The mass of a sphere is 9.83 g. If the volume of this sphere is less than __________ cm3, then the sphere will sink in liquid mercury (density = 13.6

    asked by Naria
  4. Algebra

    Boyle's Law says that the volume of a gas varies inversely with the pressure. When the volume of a certain gas is 4L, the pressure is 165 kPa(kilopascals). What is the volume when the pressure is 60 kPa?

    asked by Rachal
  5. modern physics - relativity

    A photon of energy E collides with a stationary particle of rest mass m0 and is absorbed by it . (A) what is the velocity of resulting composite particle ? (B) What is the mass of the resulting composite particle ? use conservasion of energy / momentum

    asked by walter
  6. Algebra 2

    Suppose you did a survey of male shoes size and the mean of that survey was size 10 with a standard deviation of 1.5. What is the z-score of a size of 7.5?

    asked by Adam
  7. Math

    Suppose you did a survey of male shoes size and the mean of that survey was size 10 with a standard deviation of 1.5. What is the z-score of a size of 7.5?

    asked by Wyeth
  8. Chemistry

    How many mL of concentrated HCl(aq) (36% HCL by mass, d=1.18g/mL_ are required to produce 12.5 L of a solution with ph = 2.10? First I started with finding out the concentration of [H30+] and for that I got 7.94 x 10^-3 but I don't know how to continue.

    asked by K
  9. MATH

    What is the standard deviation of the following data? If necessary, round your answer to two decimal places. 46, 53, 38, 67, 46, 57, 61, 42, 63, 55, 46

    asked by Vince
  10. physics

    Consider a situation where immediately after birth, twins are separated. One continues to live on earth, while the other is whisked away in a space ship at 90% of the speed of light. After 65 years they are reunited. Will they look the same? I know that

    asked by ashley --- HELP PLEASEE!!!
  11. MATH

    A bag has 4 green marbles, 3 red marbles, and 3 yellow marbles. What is the probability that you pick a yellow marble, do not replace it, and pick another yellow marble?

    asked by Vince
  12. Battle of the Routes

    What was the battle of the routes? how was it resolved? The battle of the routes was a battle for where the railway routes should be located. Politicians from Vancouver island thought the railway should travel across the central interior, down the Homathco

    asked by Emma
  13. Math

    What percentage of the data falls outside 1 standard deviation of the mean?

    asked by Charlie
  14. chem

    at 40 degree C , the vapour pressure of water is 55.3 mm of hg. calculate the vapour pressure at same temp. of 10%aques solution of urea??

    asked by niki
  15. math

    Which of the following are square roots of the number below? Check all that apply. 25 A. -(25)^1/2 B. -5 C. 13 D. 25^1/2

    asked by Clark
  16. Chemistry

    When ice at 0°C melts to liquid water at 0°C, it absorbs 0.334 kJ of heat per gram. Suppose the heat needed to melt 30.7 g of ice is absorbed from the water contained in a glass. If this water has a mass of 0.189 kg and a temperature of 21.0°C, what is

    asked by Lance
  17. grammar

    1. Select the sentence that has correct subject-verb agreement. (Points : 1) Applied mathematics was my major in college. Applied mathematics were my major in college. 2. Most singular nouns that end in “s”—such as politics, news, measles—take

    asked by shaunta
  18. History

    2. What was the Confucian definition of a gentleman? Why did Confucianism place so much emphasis on manners and ceremony?

    asked by Sabrina
  19. Chemistry

    (a) A 102-g sample of water is placed in an insulated container and allowed to come to room temperature at 21°C. To heat the water sample to 41°C, how much heat must you add to it? kJ (b) Consider the hypothetical reaction, being run in an insulated

    asked by Lance
  20. Ethnic Studies

    Malcolm X’s philosophy can be summarized by which of the following? ☐ a. knowing Black history ☐ b. self-determination for the Black community ☐ c. pride in Blackness ☐ d. all of these

    asked by Lisa
  21. MATH

    Triangle DEF is similar to triangle PQR. Side DE measures 3, side EF measures 7 and side FD measures 9. Side PQ measures 5x – 25 and side QR measures 6x + 4. Find the value of x.

    asked by Vince
  22. History

    Why did some senators oppose the participation of the U.S. in the League of Nations following World War I?

    asked by Laura
  23. chemistry

    three compounds A,B and C all have the formula C5H8. All three compounds will decolorize bromine in CCl4. Compound A reacts with NaNH2. Compounds A and B both yield pentane when they are treated with excess H2 with the pt catalyst. Under the same

    asked by alli
  24. 11 U chemistry

    Predict the products of a reaction between solid beryllium chloride and solid potassium,write the products in a balanced chemical equation also indicate what type of reaction this is.

    asked by timothy
  25. Chemistry

    Hydrogen is burned in oxygen to release heat. How many grams of hydrogen gas must be burned to release enough heat to warm a 50.0 g block of iron, giving 5 mol of water? 2 H2(g) + O2(g) → 2 H2O(g) ΔH = −484 kJ Iron has a specific heat of 0.449

    asked by Lance
  26. Kootenay Region

    what led to quick growth in the Kootenas? and why was this growth momentary? Silver, Copper, and other metals were discovered by prospectors in the Kootenay region which led to the growth of this region. This growth was short lived because mining towns

    asked by Emma
  27. MATH

    A bag has 5 red marbles, 6 blue marbles and 4 black marbles. What is the probability of picking a blue marble, replacing it, and then picking a black marble?

    asked by Vince
  28. Chemistry

    What is the molarity of a 37.50 mL sample of HNO3 solution that will completely react with a 23.70 of .0100 M NaOH?

    asked by Chirag
  29. intro to psychology

    teenage mothers who accustomed to exsiting on hamburgers,french fries,and cokes needs to consider the nutritional needs of the child.

    asked by stepahanie
  30. chemistry

    calculate the potential of silver electrode in a contact with the following a/ solution that is 0.0150M in I2 and saturated with AgI b/solution that is 0.0040 M in CN- and 0.0600M in Ag(CN)2^-

    asked by lyn
  31. Chemistry

    0.255 g sample of H2C2O4 required 25.70 mL of NaOH to neutralize, what would you report as the molarity of NaOH solution? the reaction is as follows: H2C2O4(aq) +2 NaOH (aq) -> Na2C2O4(aq) +2 HOH (l)

    asked by Vinny
  32. Chemistry

    What volume of .300 M CaCl2 is needed to react completely with 40.00 Ml of .200 M H2PO4. according to the following equation 3 CaCl2 (aq) + 2 H3PO4 (aq)-> Ca3(po44)2 + 6 HCL (aq)

    asked by Vinny
  33. gr10 science

    What is the critical angle in flint glass when light passes from flint glass into air? flint glass = 1.70 air = 1.0003

    asked by Rebecca
  34. Chemistry

    What is [H30+] in a solution obtained by dissolving 205mL HCl(g), measured at 23 C and 751mmHg, in 4.25L of aqueous solution?

    asked by K
  35. The Oppenheimers

    how were the oppenheimers responsible oppurtunists? They built a road from Yale to Cariboo, because transportation was slow before. i don't understand the question, and I cant find information.

    asked by Emma
  36. MATH

    What is the equation of the parabola with a directrix at y = 4 and focus (0, -4).

    asked by Vince
  37. Correction (English text)

    Hi! I'm a Belgian student and I've just taken a French-to-English translation exam. Here's what I wrote. Can you check the English (spelling, grammar, syntax...), please? Thanks :) You belong to the CIA! Joe came into our room. It was very early, the sun

    asked by green_heart
  38. geometry

    How many hours will it take a bicyclist traveling 17.6 feet per second to finish a 90-mile race? Round your answer, if necessary, to the nearest tenth.

    asked by Marcus
  39. Canadian Pacific Railway

    How did the CPR employment practices discriminate agnst Chinese workers? Why do you suppose Chinese railway workers decided to remain separated from the other workers? They were paid 1 dollar a day for the work they did, which was less than half the salary

    asked by Emma
  40. Math

    Find the vertex of the parabola. y = -4x2 - 16x - 11

    asked by CC
  41. Math

    A plane flies 150km due south and then 150km on a bearing of 45 degrees Celsius. With repeat to it initial position, find a. How far south the plane is b. how far east the plane is is c. It bearing d. How far way it is

    asked by Isaac
  42. EASY GRAPHING QUESTION

    Write the equation of a circle with a center at (2.5, –3.5) and a radius of 1.2.

    asked by Vince
  43. math

    How would I come about to the solution and what the answers to the question so I can help my son with his school work? 1.Check all the answers that are square roots of 36 a. 36^1/2 b.-(36)^1/2 c.9 d.6 e.-6 f. √36 2.)Which answers are equal to the

    asked by James
  44. Chemistry

    2MnO4-(aq) +5 H2O2 (aq) + 6H+(aq) -> 5 O2(g) + 2 (Mn2+(aq) = 8H2O (l) If a 25.00 ml sample of hydro peroxide required 25.25 ml of .353 M KMNo4 solution to react with all the hydrogen perozide what was the molarity of the hydrogen peroxide solution?

    asked by Vinny
  45. Math

    13. Find the vertex of the parabola. y = -2x2 + 12x - 13 (5, -3) (-3, 5) (3, 5) (5, 3)

    asked by CC
  46. P.S.

    A ball was dropped off a cliff and took 3.09 s to fall to the water below. Neglecting air resistance, how far (in meters) did it fall? (How far is it down to the water?)

    asked by pete
  47. MATH

    If the average cost per unit C(x) to produce x units of plywood is given by C(x)= 1200/x+40, What it the unit cost for 800 units? How much do 800 units cost in all?

    asked by HELP
  48. Math

    Find the measure of the supplement of 58 degrees

    asked by CC
  49. Chemistry

    Determine how many grams of active antacid ingredient AL(OH)3 would be necessary to neutralize the HCL in 50.0 mL of .0100 M HCL (an approximation of the conc. of HCL in the stomach) 3HCL9aq)+AL(OH)3(s)-> AlCL3 (aq) = 3H2O (L)

    asked by Vinny
  50. physical science

    A ball was dropped off a cliff and took 3.09 s to fall to the water below. Neglecting air resistance, how fast (in m/s) was the ball moving just as it hit the water

    asked by pete
  51. geography

    How does the geography of Southeast Asia affect the population diversity??

    asked by Tilli
  52. pre calc

    Find an equation of the cubic polynomial f(x) = ax3 + bx2 + cx + d that passes through the given points. P(0,-4) Q(1,-8) R(-1,-8) S(2,-2) Ive tried this every which way and i cant seem to get any of these..i know your supposed to plug it in and all but its

    asked by gabs
  53. math

    automoniles arrive at the drive-through windom at a post office at the rate of 4 every 10 minutes. the average service time is 2 minutes. the poisson distributimes are exponentially distributed. (A) what is the average time a car is in the system? (b) what

    asked by mark
  54. math

    When the rate of change between any two points on a line is negative, what is the slope of the line?

    asked by chelsea
  55. Math

    The difference between the ages of two friends is 2 years. The sum of their ages is 74 years. Find the age of the older friend. (Points : 1) 38 36 39 37

    asked by CC
  56. grammar

    is this a Parallel Sentence "Sports fans may disagree about whether going to baseball games or to watch football is more fun, but few people can ignore the importance of sports in America."

    asked by Anonymous
  57. MATH

    A bag has 4 green marbles, 3 red marbles, and 3 yellow marbles. What is the probability that you pick a yellow marble, do not replace it, and pick a red marble?

    asked by Vince
  58. Cariboo Gold Rush

    How did the Chinese turn their experience of discrimination during the Cariboo Gold Rush to their advantage? How do you suppose some local workers would have reacted to this? They started reworking claims abondoned by White miners intent on quick wealth.

    asked by Emma
  59. special relativity

    A photon of energy E collides with a stationary particle of rest mass m0 and is absorbed by it. what is the velocity of the resulting composite particle ? what is the mass of the resulting composite particle? (use conservation of momentum and energy)

    asked by Deforest
  60. chemistry

    Molybdenum (Mo) has a density of 10.22 g/cm3 and it crystalizes into a fcc unit cell, calculate the radius of a (Mo) atom?

    asked by Lilly
  61. EASY GRAPHING QUESTION

    Write the equation of a circle with a center at (15, –35) and a diameter of 100.

    asked by Vince
  62. Chemistry

    Nitrous oxide, N2O, has been used as a dental anesthetic. Suppose that the average speed of an N2O molecule at 25°C is 377 m/s. (It is actually 379 m/s.) Calculate the kinetic energy (in joules) of an N2O molecule traveling at this speed.

    asked by Lance
  63. Chemistry

    How much heat is released when a mixture containing 12.6 g CS2 and 13.2 g Cl2 reacts by the following equation? CS2(g) + 3 Cl2(g) → S2Cl2(g) + CCl4(g) ΔH° = −230. kJ

    asked by Lance
  64. BIOLOGY

    WHAT ARE THE COMPLEMENTARY BASE SEQUENCE FOR THE FOLLOWING DNA MOLECULE: GCCTACGATGCTTGTACTGAA

    asked by JESSICA SALAZAR
  65. Math

    19. Janet invested $26,000, part at 6% and part at 3%. If the total interest at the end of the year is $1,080, how much did she invest at 6%? $11,000 $10,000 $9,000 $16,000

    asked by CC
  66. PRE CALC

    Use matrices to solve the system. (If the system has infinitely many solutions, express your answer in terms of c, where x = x(c), y = y(c), and z = c. If the system has no solution, enter NONE for each answer.) 5x+2y-z=2 x-2y+2z= -1 3y+z= -17 ive done

    asked by gabs
  67. physics

    An archa fires an arrw of mas 96g wt a velocity of 120m/s @a target of mas 1500g hangin frm a piec o strin frm a tal tree. If the arrow becomes embedded in thd target wt wat velocity does the target move

    asked by Luc
  68. relativity

    A particle called neutral pi meson (or pion) decays into two photons (and nothing else).If the pion (whose rest mass is 135Mev) is initially at rest, What are the energies of the photons? How are they moving with respect to each other ?

    asked by walter
  69. MATH

    Write the equation of a parabola with a vertex at (-5, 2) and a directrix y = -1.

    asked by Vince
  70. penn foster

    industrial activities operates 5 days per week with a daily payroll of $4000. employees are paid every saturday for the workweek just completed(monday to friday). the last day of the month is wednesday, mar 31. what is the amount of wages expense recorded

    asked by ann
  71. Chmistry

    Any object, be it a space satellite or a molecule, must attain an initial upward velocity of at least 11.2 km/s in order to escape the gravitational attraction of the earth. What would be the kinetic energy in joules of a satellite weighing 2337 lb that

    asked by Lance
  72. trig

    FInd the exact value pf the 6 trig function of alpha Given: point (-2,-6) on the terminal side of the angle in standard position sin alpha cos alpha tan alpha sec alpha csc alpha cot alpha

    asked by jacara
  73. physical science

    If a ball is thrown straight up at a speed of 27.8 m/s, how long (in seconds) will it continue to rise before it starts to fall back down

    asked by pete
  74. PS

    Does it look to you like Aristotle ever performed any actual experiments with falling objects? Explain your answer, based upon your observations from this lab .

    asked by pete
  75. Math

    Determine whether or not the relation is a function (1,9)(2,10)(3,11)(4,12)

    asked by CC
  76. global history.

    What did people in Ancient Greece trade with other countries? What were the trade routes, what did they trade, and finally, what was the effect on Greece ?

    asked by Jenna
  77. spanish

    I need someone to edit a spanish article for me. I can just email it to you if you leave your email here. Thanks!

    asked by Jo
  78. Relativity

    A particle called neutral pi meson (or pion) decays into two photons and nothing else. If the pion (whose rest mass is 135Mev) is initially at rest (a) what are the energies of the photons? (b)what are the magnitudes of the momenta of the photons? (c) How

    asked by Deforest
  79. physics

    A cart of 2kg travellin @6m/s collides wit another cart of mass of 0.4kg travellin in the same direction @ 2m/s. The 2kg cart bounc off and !@#$%^&inues wt 3m/s in the same direction after impact.calculate the velocity of the 0.4kg trolley afta collision

    asked by Lara
  80. Chemistry

    The specific heat of copper metal was determined by putting a piece of the metal weighing 39.4 g in hot water. The quantity of heat absorbed by the metal was calculated to be 47 J from the temperature drop of the water. What was the specific heat of the

    asked by Lance
  81. Math

    Determine whether the system is consistent, inconsistent, or dependent. 2x + 2y = 2 6x + 6y = 6 or consistent and dependent

    asked by CC
  82. Statistics

    A bag of marbles has 5 Green, 4 Red, and 3 yellow marbles. Three marbles are randomly drawn from the bag, without replacement: What is the probability that at least one of the three marbles drawn are red? What is the probability that only one of the three

    asked by dan
  83. relativity

    Show that the following process is dynamically inpossible: A single photon in empty space is transformed into an electron and a positron, each with rest mass m(e).Explain in detail, How can this this process be made possible? In this case, what is the

    asked by walter
  84. algebra

    Solve the system of equations by graphing. Then classify the system. 2x-y=7 2x+3y=3

    asked by sam
  85. chemistry

    if 10 ml of a 2M standard solution is used to neutralize 20mL of an unknown base what is the molarity of the unknown and is this standard solution an acid or base?

    asked by jessica
  86. MATH

    Find the only positive integer whose cube is the sum of the cubes of three positive integers immediately preceding it. Find this positive integer. Your algebraic work must be detailed enough to show this is the only positive integer with this property

    asked by Janice - Please Help!!!
  87. physics

    A ball bearing is dropped from rest at a point A. At the instant it passes a mark 4.5 m below A, another ball bearing is released from rest from a position 5.5 m below A. 1) At what time after its release will the second ball bearing be overtaken by the

    asked by tank
  88. chemistry

    does a fission reaction release one-fourth of the amount of energy released ina fusion reaction?

    asked by Anonymous
  89. Chemistry

    C2H5OH + O2 -> C2H4O2 +H20 This reaction drastically changes the taste of wine, if 100.0 mL of wine initially contained 12.0 g of ethanol and after a period of time 4.00 g of acetic acid were detected, what percent of the ethanol had been converted?

    asked by Vinny
  90. Chemistry

    A 19.5-g sample of a metal was heated to 61.67°C. When the metal was placed into 27.1 g of water in a calorimeter, the temperature of the water increased from 25.00°C to 30.00°C. What is the specific heat of the metal?

    asked by Lance
  91. chemistry

    An electromagnetic field is generated by: A) an electron moving at constant speed in a straight line B) a proton moving in a circle C) an neutron moving in a circle D) neither

    asked by James
  92. Math

    In triangle ABC, angle C is a right angle. Find the measure of angle B if side b = 105 m and side c = 139 m. (Points : 1) 49° 59° 53° 47°

    asked by CC
  93. chemistry

    Will the following reaction occur Spontaneously? Show your work and reasoning in each case 1. Ca(s) + Sn^4+ -->

    asked by Aidan
  94. math

    What is the equation for a line in slope intercept form passing through (2,11) and perpenduclar to y =4

    asked by Anonymous
  95. gr10 science

    What is the index of refraction of a refractive medium f the angle of incidence in air is 30 degrees and the angle of refraction is 15 degrees?

    asked by Rebecca
  96. Math

    Can (4x^3)y - 9xy^3 factor?

    asked by Jessica
  97. Chinese in Canada

    How did the employing practices of Chinese labour contractors lead to prejudice? How did they take advantage of Chinese workers? The Knights of labour campaigned to have all Chinese removed from Vancouver. The kings would also often force Chinese residents

    asked by Emma
  98. ALGEBRA

    Explain how factoring is used to solve quadratic equations. Demonstrate the process with an example.

    asked by nina
  99. Maths

    Pls i urgently need solution to this problems(1) in angle xyz. Y=298cm,z=51.4cm,x=196cm.solve the angle completely. (2). Calculate the values of anglesA and C of MABC where b=14.36cm a=7.82cm B=115.6cm. (3). a,A,angleC in angleABC given that

    asked by Malosky
  100. Math

    A bag has 4 green marbles, 3 red marbles, and 3 yellow marbles. What is the probability that you pick a yellow marble, do not replace it, and pick a red marble?

    asked by Vince
  101. FRENCH

    From the same Activity--- Number 3. 3. ranger sa chambre. Sydney: Tu as rangée sa chambre? Sam: Non, je n'ai pas rangée sa chambre. Does sa chambre change the sentence at all? Is it supposed to be "ta" chambre? I'm asking--did you clean your room, and

    asked by Sydney
  102. EASY MATH QUESTION

    What is the probability of rolling a 1, 2, 4, 5, or 6 on a six sided dice? MAKE SURE TO READ THE QUESTION CAREFULLY!

    asked by Vince
  103. EASY MATH

    Write the equation of a hyperbola with a center at (-5, -3), vertices at (-5, -5) and (-5, -1) and co-vertices at (-11, -3) and (1, -3).

    asked by Vince
  104. child care

    which of the following taxes must be paid only by the employer? A Federal income B State C Federal unemployment D Fica Thanks

    asked by Alex
  105. Algebra

    Solve the system of equations by graphing. Then classify the system. x+y=11 x-y=-5

    asked by Lee
  106. poly

    justin had nickels and dimes in his pocket. When he counted out his change, he had 80 cent. if there are 12 coins altogether, how many dimes did he have?

    asked by srilee
  107. personal dimension of Education

    what is a credible website?

    asked by Rebecca
  108. English

    Can you help me express the following sentences? Especially sentence 3. 1) Herewith I'd like to confirm the booking for a double room in half board for five nights. 2) Here are the datails of my credit card. 3) According to your hotel cancellation policy,

    asked by Henry
  109. MATH

    you purchase 8 video game machines for a total of $2722. A nintendo costs $249 and an Xbox costs $395. How many nintendos and how many xboxes did you buy? What 2 equations do I write and how do i solve it? (elimination substituation etc.)

    asked by HAILS
  110. Math

    prove f_{2n+1} = f_{n+1}^2 + f_n^2 Where f is the fibonacci sequence (so f_1=1, f_2=1, f_3=2, f_4=3, f_5=5, etc)

    asked by Sean
  111. science

    You are at the center of a current-carrying solenoid (#1). You are experiencing a magnetic field B1. You replace this solenoid with a different solenoid (#2). The length of this replacement (#2) is double of (#1) with double as many turns of (#1). You will

    asked by Kathy
  112. Algebra

    How would i solve for this problems? also what is the answer(s) 5.)Which answers are equal to the expression √16 x √25 a.√41 b.√16 x 25 c.(16 x 25)^1/2 d.20 e.400 f.√25 x √16

    asked by Clark
  113. special relativity

    A projectile of rest mass M1, total energy E1, and momentum p1, is directed at a stationary target of mass m2. Find the the velocity of the centre-of-momentum frame .

    asked by Deforest
  114. physic

    You own a yacht which is 14.5 meters long. It is motoring down a canal at 10.1 m/s. Its bow (the front of the boat) is just about to begin passing underneath a bridge that is 30.0 m across. How much time is required until its stern (the end of the boat) is

    asked by coolstir
  115. science

    You are standing 20 cm directly away from from the mid-point of a long, straight current carrying wire that runs east/west and are experiencing a magnetic field B1 due to the wire. If you were to move a new location that is 7 cm to the east of your initial

    asked by james
  116. THIS IS AN EASY QUESTION!!!

    (too bad I don't know how to solve it!) How many different ways can the letters in the word “square” be arranged?

    asked by Vince
  117. Math

    10. Find the slope of the line passing through the points (10, 0) and (0, 3). (Points : 1) -10/3 10/3 3/10 -3/10

    asked by CC
  118. Math

    11. Determine whether or not the relation is a function. {(-3, 6), (-2, 7), (-1, 8), (0, 9)} No Yes

    asked by CC
  119. Grammar

    Select the correct statement: A) The subject of the sentence is that part about which something is being said, and it sometimes contains a noun or pronoun. B) The predicate of the sentence is that part about which something is being said, and it always

    asked by Diane
  120. pre calc

    Find the values of b such that the system has one solution. x^2 + y^2 = 36 y= x+b and then they give me an answer box b=_________ (smaller value) b=_________ (larger value) i have absolutely no idea how to even begin this and what they are asking. could

    asked by gabs
  121. math

    Your car can go 375 miles on 12 gallons of gas. How far can you go on just 7 gallons of gas?

    asked by Anonymous
  122. Chemistry

    Suppose you mix 20.1 g of water at 66.2°C with 45.1 g of water at 35.7°C in an insulated cup. What is the maximum temperature of the solution after mixing?

    asked by Lance
  123. chemistry

    Could you please explain to me how to balance a chemical equation? I've been trying to figure it out, but I can't seem to understand it at all.

    asked by Taz
  124. chemistry

    how many moles of CO2 in .05M solution in .2L?

    asked by Stacey
  125. physics (non-calc)

    A particle of charge 2.5x10(^-6)C is moving at 1000 m/sec in a direction 30 degrees North of east. At the location of the particle the magnetic field has size 0.2 T. The particle is experiencing an instantaneous magnetic force (due to this sheild) of

    asked by phil
  126. Writing

    Could you proof read my informal essay? Title: Who Needs Alcoholics Anonymous? Dear Friend, Sorry for not writing earlier, but I’ve been very busy preparing for my class and taking care of my family. I use to think that drinking beer was cool, but I soon

    asked by Amantha
  127. physics (simple question...need help pls!)

    The magnetic field is generated by: A) an electron moving at constant speed in a straight line B) a proton moving in a circle C)a neutron moving in a circle D) none

    asked by john
  128. FRENCH

    Do Passer and Ranger have an accent at the end when they are in past tense? Or are they just Passe and Range. I added that accent on them in that activity.

    asked by Sydney
  129. geometry

    ABCD is an isosceles trapezoid with a height of 4 inches and bases of 10 and 12 inches .What is the perimeter of this trapezoid in inches and feet . HINT:Only the bottom of the entire figure is 16 inches long, not the top

    asked by Veronica
  130. COLLEGE ALGEBRA ..HELP!

    Solve by completing the square 12x^2+11x=5

    asked by KARINA
  131. daycare

    You've decided to operate a day care home. Which one of the following factors is the most important in helping you make your decision? A. Your family is willing to share their living space with the children in the program. B. Your home seems to be large

    asked by aj
  132. Math

    Find the coordinates of the x intercept 2x + y = -6

    asked by CC
  133. science

    ways in which hydrology can have positive or negative impacts on the ecosystem. cant find any helpful sites please help

    asked by Alie
  134. grammar

    hello. is this statement correct in grammar: i think something is weird at this picture, but i can't seem to find it. thank you in advance.

    asked by Namie
  135. trig

    I get that we have to put it into radical form, but I don't understand the process. Can someone walk me through it and explain it? arccos(-1/2)

    asked by Master chief
  136. FRENCH

    Please check to see if I've done this activity correctly. There's just so much to cover. Reflexive verbs, vandertramp, and avoir are all in this activity. Interviewez des élèves de votre classe pour déterminer ce qu'ils ont fait pendant le weekend. Sur

    asked by Sydney
  137. com155

    Have I used adjectives and adverbs correctly here? Adjectives() Adverbs"" have I got them all? When I was (younger) I learned that I had to be "very" (careful) with credit cards. (Managing) debt can be a (difficult) task. I know that it is "extremely"

    asked by blake
  138. History

    What was the most important foreign policy goal of the United States between 1945 and 1990?

    asked by Laura
  139. law

    In the video game Corporate Cowboy, your task is to investigate complaints of wrongdoing on the part of corporate directors and officers, decide whether there is a violation of the law, and deal with the wrongdoers accordingly. Jane, a shareholder of

    asked by mark
  140. science

    An 80kg golf hall is struck for a period of0.03s wt a force of 500n.the bal accelerate frm the tree.wat is its final speed.

    asked by Luc
  141. English - essay

    Hi. Im writing a short story about a girl who helped the army during world war II and i wonder would you know any famous quote about life/its challenges or anything that could suit the topic that I could use to finish off? Thank you

    asked by Rebecca
  142. Statistics

    Employees in a large computer firm claim that the mean salary of the firm’s programmers is less than that of its competitors. The competitor’s salary is $47,000. A random sample of 30 of the firm’s programmers has a mean salary of $46,500 with a

    asked by Kelly
  143. Calculus ll

    Find the partial derivative of the function with respect to each of the independent variables.f(x,y)=xe^2y

    asked by Chris
  144. math

    4x-(3-x) = 7(x-3) +10 how do i get the answer 4

    asked by israel
  145. com 155

    Have I used good and well correctly? In my opinion, your book is very good. The text is extremely well written. You did well explaining the rules of grammar. I am a good reader and this book was easy to follow and understand. I especially like the

    asked by blake
  146. math

    If I invest $1,000 today in a Profit-Sharing Plan and earn a 6% return on my money, approximately how long will it take me to double your investment?

    asked by shyla
  147. Math

    Determine whether or not the network is traversable. (Points : 1) No, it is not traversable. Yes, it is traversable.

    asked by CC
  148. math

    (x + 5) -2(4x -1)=0

    asked by karissa
  149. math

    In how many ways can 8 instructors be assigned to five sections of a course in mathematics

    asked by kozy
  150. Geometry

    Nickles are made from a metal that is a mixture of nickle and copper. About how many nickles can be made if a 1 meter cubed block of this metal is melted down?

    asked by Caty
  151. business

    What benefits do employees receive from a well developed and implemented code of ethics?

    asked by Mel
  152. History

    Why did imperialism become popular again during the last quarter of the 19th century?

    asked by Laura
  153. social studies

    the collapse of Japanese control in Korea in 1945, a line had been drawn across the peninsula by the Allies at the __________________ Parallel, with the Soviets establishing control north and the Americans doing the same to the south. 05. Soviets

    asked by Anonymous
  154. Math

    18. Find the value for the correlation coefficient r. (Points : 1) –0.073 –0.094 –0.203 –0.149

    asked by CC
  155. Canadian Pacific Railway

    How did the CPR & other railroads serve to increase economic growth in BC? All i can come up with is that they gathered tourists.

    asked by Emma
  156. math

    mathematical expression of: 1.) 75-5 2.) 14x(3+4) 3.) 3x(11+6) 4.) 1+(6+8) 5.) 20+5-80 6.) 4x2+5

    asked by patrick
  157. algebra1

    Find the product: (x + 5)2 12 Answer: Referring to the figure, find an expression for the area. 13 Answer: Use the zero-product property to solve the equation: (x + 4)(x - 2) = 0 *NOTE: Applicable to this and all other questions-- For any solution that

    asked by peaches williams
  158. physics

    The magnetic field at point 1 is 0.20 T directed north of east. The north component of this field at point 1 is most nearly (in T): -0.129 -0.153 -0.20 -0.035 0 -0.1 0.173

    asked by sue
  159. Math

    Find the domain and range of the relation, and state whether or not the relation is a function (1,3)(2,3)(3,3)(4,3)

    asked by CC
  160. Math

    Find the measurement of the supplement of 58 degrees

    asked by CC
  161. algebra1

    How much is 40% of $80? show me how to do this?

    asked by peaches williams
  162. English

    Hello. Please tell me whether the sentences sound natural English: 1)There are expectations that Congress will approve the bill. 2) There are expectations about his victory. Does it have the same meaning as "it is expected that Congress will approve..."?

    asked by Ilma
  163. French

    Which form of conjugation would I use for the following? Like would I use the tu, vous, nous, il, elle, etc. form for which one? -Les enfants -Ma famille -Les adultes -Ces fruits coupes Thanks

    asked by Erika
  164. Organic Chemistry

    how to calculate specific observed rotation?

    asked by Tee Kay
  165. AED 201

    interview with a teaching professional

    asked by Gloria Jackson
  166. health

    a 7 yr old boy breaks his tibia and requires immobility by a hard cast for 6 weeks initl it heals. a potential consequence of this therapy is atrophy of the

    asked by cheri
  167. illinge high school

    Name two institutions that are involved in supporting or giving redress to pollution

    asked by tebogo
  168. FRENCH

    Spot my own error numero 9 9. s'habiller bien pour sortir Sydney: Tu t'es habillée bien pour sortir? Brittany: Non, je ne suis pas habillée bien pour sortir. Is a "me" supposed to go between ne and suis?

    asked by Sydney
  169. calculus

    integratex^4+1/x^6+1

    asked by gurvinder
  170. physics

    when you peddle a cycle, it goes fowrward, when you backpeddle-nothing happens. why?

    asked by ashutosh
  171. fractions

    what is 5 3/7 x 1/11 equal

    asked by nan
  172. American History

    What was the Voluntary Program? (this is at the time of the Great Depression. Possibly in the new deal? Not sure.)

    asked by Nicole
  173. algebra1

    (2x^2+3x-15) divided by (x-3)

    asked by ash
  174. math

    (3x2(3)/11-5(5))^2

    asked by jared
  175. math

    1/3x+5(12-x)=2x

    asked by Robert
  176. math

    1/3x+5(12-x)=2x what would "x" equal? how did you solve it?

    asked by Robert
  177. math

    what is a 40% mark up on an item that costs-$38.00?

    asked by jeff