Questions Asked on
October 22, 2006

  1. science

    Hi, this question was posted by liverpool I see but has not been responded to after 2nd entry each time. What happens when a candle is alight. Having to show chemical/physical change. The question is 'Explained both changes using the Big Idea of Energy'?

    asked by melody
  2. BUSINESS LETTERS

    Which element is always included in a well-written business letter: A. HANDWRITTEN SIGNATURE B. ATTENTION LINE C. POSTCRIPT D. IDENTIFICATION INITIALS THANK YOU FOR RESPONDING! B or it never gets where it is intended to I'd choose A. Not every business

    asked by Rhonda
  3. Economics Help

    A neoclassical theorist would use the formula Y = (w r * L s) + (I r * K s) to explain why a given person, John, is poor. a) According to the Neoclassical Theory, how would John decide how many hours of labor to supply? Draw an appropriate diagram to

    asked by Kim
  4. english

    what's a dedication Thank you for using the Jiskha Homework Help Forum. In the dedication you say to/for whom the book was written. Here is one of the definitions from a dictionary: a name and often a message prefixed to a literary, musical, or artistic

    asked by lynn
  5. english

    what's an introduction Thank you for using the Jiskha Homework Help Forum. An introduction "introduces" what you are going to say! The thesis statement could be in the introductory paragraph but it isn't necessarily always there. Here might be an easy way

    asked by lynn
  6. Governent

    How do people with a despotism government select their leaders? A despot is like a dictator, they dont,except by violent overthrow, usually http://www.answers.com/despot Ken's right -- the people generally don't choose a despot!! =)

    asked by Lanna
  7. Chem.

    Convert 512 ft to km. Anyone know how to do this, please? There are 3281 feet/km. In order to get it in km, you have to divide... 512/3281 = Thank you! yo this is fo reak dawg 512ft(1km/3218ft) ft cancel eachother out n u are left with km .15605km

    asked by Frank
  8. Math/Financing

    I need help with a math problem. If someone finances an item at an apr rate of 17.99% interest, and pays all charges off in 2 months, what will the total amount paid for the item be. Assuming there is no annual fee and the minimum finance charge is $2.00

    asked by Trevor
  9. Science

    Meat tenderizers contain enzymes. How do these enzymes affect protein in meat? The enzymes break the tendons and muscle to make them more chewable. As I understand it, however, the protein content that is usable in the body is unchanged. The enzyme simply

    asked by Kristen
  10. Derivatives

    What is f ''(x) and f ''''(x) of f(x)= e^-x^2 f"(x) = -e^-x^2(2x) F""(x)= -2e^-x^2 + 2xe^x^2 and also what is integral [0 to 2] f(x) dx

    asked by 413
  11. counting

    how many squares are in an 8x8 checkerboard? (the answer is not 64 because that's too low.) Thank you for using the Jiskha Homework Help Forum. Unfortunately, you don't state the size of each square. Hopefully the following will answer your question!

    asked by Seth
  12. math

    how manyyards are in a mile? 1760 I think There are 5,280 feet in a mile. There are 3 feet in a yard. 1 mi x (5,280 ft/1 mi) x (1 yd/3 ft) = ?? Note that the first factor cancels miles and changes miles to feet, the second factor cancels feet and converts

    asked by selina
  13. Math

    I need help multiplying the fractions out. The question is... x/3 + y/2 = -4 x - 3y = 6 ( x/3 is a fraction ) To rid an equation of fractions, simply multiply everyting (both sides, too) by the denominator. In this case you have two numbers in the

    asked by Jessica
  14. Math

    Can someone please help me write this statement out in formula form. There should be two formulas. Question.... Three times the larger of two numbers is equal to four times the smaller. The sum of the numbers is 21. Find the numbers. If we let X = larger

    asked by Jessica
  15. help

    my bf is kissing me on friday and i don't know how to kiss!!!!!!!!!how do i kiss him if im not experienced!!!!!!!!!!!!!!!and believe me this isssss homework This is not homework u dumb butt! That is social!! DUMB BUTT!!!!!!

    asked by chemiii
  16. Math

    Hi, would someone mind just checking the answer I got for this formula and tell me if I'm on the right track or not. Question... x+y=21 3x=4y Answer I got... x=84 y= -63 I didn't get that. Check your math. I found 7y=63 but not y = 63. You can always check

    asked by Jessica
  17. us history

    where can i find an excellent website about the Lac Courte oreilles Band of lake superior chippewa? about history, population, activities and things This is a fantastic site. It should have everything you need. http://www.lco-nsn.gov/ Information from

    asked by robin
  18. history

    can anyone find a website on the lac courte oreilles band of lake superior chippewa? like history,population, activities and shelter Since I am not aloud to post any websites in my answer here is what you do: Go to google and search "Lac Courte Oreilles

    asked by robin
  19. Chemistry

    Balloon- CO2 Balloon- O2 Balloon- He Balloon- N2 Balloon- CH4 Represented above are five identical balloons, each filled to the same volume at 25 degrees Celcius and 1.0 atmosohere pressure with the pure gases indicated. A) which balloon contains the

    asked by Tina
  20. Chemistry

    The preparation of "azo" dyes often does not work well in laboratory. Alought the correct colour is usually apparent, very little product is obtained. Seeing this, a student decides to modify the experimental procedure and obtains a record quantity of

    asked by Lucian
  21. Chem! hELP

    An experiment is preformed to determin the empirical formula of a copper iodide formed by direct combination of elements. A clean strip of copper metal is weighed accurately. Its is suspended in a test tube containing iodine vapor generated by heating

    asked by ALie
  22. Question

    Fill in the blank with the correct word. Regardless of what others say,I would advise you to_________ to George's judgement. (defer,differ) I think it is Reardless of what others say, I would advise you to DIFFER to George's judgement. I'm not sure if I'm

    asked by Miranda
  23. Question

    Fill in the blank with the correct word. 1.Regardless of what others say,I would advise you to_________ to George's judgement. (defer,differ) 2.All things considered_______ not a bad day,since morale is excellent. (it's, its) The apostrophe means it's is a

    asked by Miranda
  24. Science

    How does osmosis explain the fact that a watery syrup forms when you put sugar on strawberries? Sugar dissolves in some of the surface water molecules making a high concentration of sugar solution. The osmostic pressure is changed significantly; the result

    asked by Marie
  25. physics

    four 9.5kg spheres are located at the corners of a square of side 0.60m. calculate the magnitude and direction of the total gravitational force exerted on one sphere by the other three Let s be the side length, so the diagnoal length is s * sqrt2. This is

    asked by sarah
  26. Mobility and Rf

    We did a column chromatography then a TLC on extracted spinach pigments. Question: Why are the chlorophylls less mobile on column chromatography and why do they have lower Rf values than the carotenes? My answer: The chlorophylls are more polar than the

    asked by Sheryl
  27. science

    What are 3 chemical properties of iron and 2 chemical properties of sodium? http://chemistry.allinfoabout.com/periodic/fe.html http://chemistry.allinfoabout.com/periodic/na.html Thanks. That helped a little.

    asked by Matthew
  28. Concentration increase

    Question: What would happen to the Rf values of the pigments if you were to increase the relative concntration of acetone in the developing solvent? Note: The development solvent used was 70% hexane - 30% acetone. My answer: Acetone is more polar than

    asked by Sheryl
  29. math (unit rate)

    how would i get the answer to this problem-$1.60 for 8 rolls? I think you are asking how much it would be for 1 roll. If it is $1.60 for 8 rolls, you need to divide this my 8 to get the price for 1 roll. 5y6y67

    asked by sydney
  30. Chemistry

    How do I make NH3 to NH4? How would write an ionic equation? Can you show me how to do it? Thank you so much! NH3 + CuSO4 -> NH3 adds a hydrogen ion (from HCl or another source of H^+) to become NH4^+. There is no such animal as NH4 as a neutral material.

    asked by Kelly
  31. Purity

    The question asked is: Using yur results as a guide, comment on the purity of the material in the green and yellow bands. (from a TLC of spinach extraction pigments.) I'm not quite sure what they want here and my plate is in the lab, not here. There were

    asked by Sheryl
  32. Windows XP Security-NEED ASAP

    12. You are called by a department manager who wants one of his employees to have access to a specific document in the manager’s home directory. The department manager wants to retain the file in his own home directory, rather than move it to a share.

    asked by Soly
  33. history

    Why did Thomas Jefferson believe that Classical Revival was more appropriate style than Georgian for public buildings in the new United States? Why did thomas jefferson believe classical revival was a more appropriate style than georgian for public

    asked by emmy
  34. Ethnic/HELP ME

    I 've checked and looked around where can i find the definitions to these terms. So i can answer this question on behalf of the race of mexican. Did mexican participated in any of the following forms of discrimination if so describe(Dual Labor

    asked by Jasmine202005
  35. the big idea of energy KS3

    what is the big idea of energy? To A. Einstein, it was that Energy and Mass are equivalent, and that the sum total of both, with a factor called entropy, is constant in the universe. what is the big idea of energy i need help on finding out what the big

    asked by blue babe
  36. Inventor

    Does anybody know a VERY imformative sight about James T. Russell? Search his name on google and you can find some websites. I think the first one is kinda good. I was searching for a specific site. web.mit.edu/invent/iow/russell.html This seems to be a

    asked by kaylmur
  37. James T. Russell

    is he dead? I don't believe so. Nothing on the web indicates that he is.

    asked by needs help
  38. stoichiometrics

    What is the mass of each and which is greater? 1g H2 + ?N2 and 1g H2 + ?O2 I've balanced them to this point: 3H2 + N2 ===> 2NH3 2H2 + O2 ===> 2H2O Help please, I am stuck on this step and cannot get any further. Thanks, PJ Good! You've done the hard part.

    asked by Penny
  39. how do protons move during electrophoresis

    During electrophoresis, protons move in the same direction as DNA. do not move at all. move in the opposite direction as DNA. move randomly. I am thinking they move in the same direction as DNA or am I wrong? DNA travels in accordance with its principal

    asked by Kellie Jo
  40. math

    what is the number of noncollinear points that determine a cirlce infinite The minimum number of noncollinear points that will determine a unique circle is 3.

    asked by bill
  41. MaTH

    $89.00MIN/HOUR=$_____/SECONDS $5340.00

    asked by vANESSA
  42. Human Resource Management

    Select an industry that you would like to examine in depth. Consider the HR department and its function within organizations that operate in that industry. Write a 1,400-2,100-word paper in which you identify five major HR challenges either currently

    asked by Donna Hughes
  43. The lion,the witch, and the wardrbe. in ch. 12-14

    What does the witch prepare to do to Edmund? to kill him

    asked by Aarona
  44. social studies

    why did germanic leader clovis convert to christanity, a religion he had ridiculed? Clovis saw that he could gain the help of Byzantines, Romans, and the Gauls by converting to Roman Christianity. If this had not occurred, European history would have gone

    asked by shyakyla
  45. chemistry

    Can specific heat be negative? I know energy can be (as in joules or calories) because when something cools down the temperature difference is a negative, and because the energy is an important part of the formula for specific heat, couldn't it be

    asked by Fido
  46. calculus

    My a.p. calculus teacher doesn't know how to do this problem (like many others) so he's giving us 5 points extra credit on our test if we can figure it out, but I don't know how to do it: It's as the lim-->infinity (x+sinx)/(x+cosx) We know the answer is 1

    asked by teamcaridee
  47. GOVERNMENT

    What part of the government is most removed from control of the people?legislative, executive, judicial Which of those three is composed of people NOT elected by the registered voters?? ?? It must be judicial Is that right? Right. =)

    asked by Suzanne
  48. GOVERNMENT

    Explain why the system of checks and balances makes it impossible to change the philosophy of governemtn in one election. The Supreme Court members serve life terms. Only 1/3 of the Senate can be replaced in a given election. Those branches of the

    asked by Suzanne
  49. GOVERNMENT

    Under the original constitution, which was the only part of the national government directly elected by the people? What is your answer to this question? We'll be glad to check your answer.

    asked by Suzanne
  50. find the point

    At what point of the graph of x^2 / 2 is the tangent line parallel to the line 2x-4y = 3 TIA

    asked by Jen
  51. evaluation

    Evaluate 1. sin(tan inverse sqrt(x^2-2x)) 2. tan (sec inverse 3y)

    asked by Jen
  52. science

    What is a timberline? Timberline: On mountains and in frigid regions, the line above which there is no timber.

    asked by Brittany
  53. science

    What is a timberline? Timberline is the highest elevation where trees grow, in a mountainous area. Above the treeline, there are just alpine flowers and small shrubs. Further up, nothing grows at all. thanks :)

    asked by Brittany
  54. math.

    write as a radical: x(to the power of)4/3 Cube root of x^4.

    asked by shelby
  55. science

    What is a chaparral?Where can you find them? It's a biome of drought-tolerant shrubs. You find it in semi-arid deserts, particularly in California and Mediterranean regions. It is much of what burns when you see southern CA fires on TV. See

    asked by Brittany
  56. blood clotting

    are blood clotting factors released from platelets, plasma, and damaged cells are is there only one of those that is more prevalent/obvious. The blood clotting factors are in the plasma.

    asked by JaWarrien
  57. Math

    592 divided by 48 = 107 divided by 19 = Try using long division and expressing the remainder as a fraction. Do you have a hand calculator? 592 divided by 48 = 12 1/3 107 divided by 19 = 5 12/19 592 divided by 48 = 12.3 107 divided by 19 = 5.6

    asked by Brittany
  58. math

    "fashion furniture makes two kinds of chairs; rockers and recliners. two machinges a and b are used. machine a is limited to 20 hours per day. machine b is limited to 15 hours per day. machine a takes two hours to make each rocker and four hours to make

    asked by jessa
  59. science

    similarities between the terrestrial biome and the aquatic life zone? Think... There is a food chain, right? Where does the chain start in both places? Where does it end. What about the cycle of nutrients? Bob

    asked by stacy
  60. English

    Can you read and correct my two paragraphs? Thanks. In John Smith’s The General History, he writes to dispel myths about the New World and to convince others to come there. He tells the reader how he was able to outwit the Indians in three ways. First,

    asked by Sara
  61. GOVERNMENT

    Why did the makers of the Constitution provide "Filters" between the voters and the U.S. Senate and the presidency? The French revolution convinced many that the masses sometimes got out of hand, so in the Constitution, the States Legislatures chose the

    asked by Suzanne
  62. GOVERNMENT HELP

    Under the original Constitution, which was the only part of the national government directly elected by the people? Which of the three branches do you think was the only one elected directly by the people? executive? House of representatives elected by the

    asked by Suzanne
  63. capitalism

    What are the pros and cons of capitalism? Please post your answer, and we'll be glad to critique it.

    asked by Janet
  64. history

    About the buildings... Why did Thomas Jefferson believe that Classical Revival was more appropriate style than Georgian for public buildings in the new United States? The Classical Revival architecture reflected tha ancient Greek ideals of democracy.

    asked by emmy
  65. Ap Chem

    If in an experiment we're working with Mg, HCl acid, and H20. We stick the magnesium in the acid mixed with water and the Mg dissolves. One of the products is hydrogen gas. If the water in the tube is evaporated, the other product, a white salt remains.

    asked by Justyna
  66. Ap chem question 2 related to the first question

    Calculate the volume of gas you would expect to be evolved in X mol of magnesium were reacted with an excess of HCl at standard conditions. I'm going to tell you what my father told me...LOOK IT UP thanks for the unnecessary comment! Mg + 2HCl ==> MgCl2 +

    asked by Justyna
  67. salivary amylase

    Salivary amylase is secreted by the salivary glands, and catalyzes the breakdown of starch and glycogen to smaller polypeptides. the breakdown of starch and glycogen to smaller polysaccharides. the breakdown of proteins to smaller polypeptides. the

    asked by Anonymous
  68. math

    How do i solve inequalitites with three variables. I still can't figure it outplease help. x+y=1 y-z=-3 2x+3y+z=1

    asked by Jasmine202005
  69. Math Help Please

    How do i solve inequalitites with three variables. I still can't figure it outplease help. x+y=1 y-z=-3 2x+3y+z=1 Where are the inequalities? Those are equations.

    asked by Jasmine202005
  70. science

    I am in middle school and we are doing a catapult projectile lab. The question is, using knowledge of force, motion and projectiles, can a catapult be built to accurately project a marshmellow toward a designated target. We have to change the angle of

    asked by Wendi
  71. a.p. calculus help please!

    My a.p. calculus teacher doesn't know how to do this problem (like many others) so he's giving us 5 points extra credit on our test if we can figure it out, but I don't know how to do it: It's as the lim-->infinity (x+sinx)/(x+cosx) We know the answer is 1

    asked by teamcaridee
  72. TO DRWLS/MATH HELP PLEASE

    How do i solve inequalitites with three variables. I still can't figure it outplease help. x+y=1 y-z=-3 2x+3y+z=1 THE ANSWERS ARE X=3,Y=-2,Z=1 i KNOW THE ANSWERS I JUST DON'T KNOW HOW THE BOOK GOT THE ANSWERS . i 'VE TRIED MANY DIFFERENT WAYS AND I STILL

    asked by Jasmine202005
  73. language arts

    my 5th grade son needs help in writing. He does not know how to organize and formulate his thoughts onto paper. Do you know of any sites that might help him with this? http://www.internet4classrooms.com/skills_5th_lang.htm#writing really he could just make

    asked by Cindi
  74. math

    how do you graph a linear equasion I BELIEVE ITS Y=MX+B FORMULA AND THE SLOPE FORMULA what? please explain

    asked by Nikki-Ole
  75. DRWLS CAN YOU ANSWER

    How do i solve inequalitites with three variables. I still can't figure it outplease help. x+y=1 y-z=-3 2x+3y+z=1 THE ANSWERS ARE3,-2,1 HOW DID THEY GET THAT ANSWER. This can be solved a number of ways. 1) subsitition 2) determinants 3) matricies.

    asked by Jasmine202005
  76. to annonymus can you help me with math

    How do i solve inequalitites with three variables. I still can't figure it outplease help. x+y=1 y-z=-3 2x+3y+z=1 the answers are 3,-2,1 how do get there by solving linear equations with three variables. 5x-2y-z=2 -y+2z=11 x+y+z=-3

    asked by Jasmine202005
  77. math

    ahhhhhh...i cant seem to figure out how you graph an equation(linear) a linear equation is y=mx+b right. so m is the slope, b is y intercept. x and y are points. so what you can do is substitute a point to get another. for x: y=5x+3 For x=1, y=8 so (1,8)

    asked by Nikki-Ole
  78. Integration

    What is integral [0 to 2] e^-x^2 dx You are talking about the error function. That integral cannot be expressed in a closed form in terms of other simple functions. The answer I get, taken from an error function table, is 0.99532 * [sqrt(pi)]/2 =0.88208...

    asked by 413
  79. Social Studies

    Could you please help. I need the torture methods for children and non-Christans in the middle ages. http://en.wikipedia.org/wiki/Torture

    asked by Miriam
  80. social studies

    How far does the coastal plain extend Which coastal plain? Please explain, and we'll try to help you.

    asked by Austin
  81. science HELP!!!!!!!!!

    What role does nitrogen play in plant growth

    asked by SW
  82. weighted averages

    How do you do this? a pineapple drink contains 15% pineapple juice. how much pure pineapple juice should be added to 8 quarts of the drink to obtain a mixture containing 50% pineapple juice? Let X be the amount of pure pineapple that you must add, in

    asked by Em
  83. dna strands/sequences

    The restriction enzyme EcoR1 recognizes the DNA sequence GAATTC. Which DNA strands will be cut by EcoR1? I. TTCAGGAATTCGGAAACC AAGTCCTTAAGCCTTTGG II. TGAATCGAACCTG ACTTAGCTTGGAC III. TTAAGCGGCCGAATTCAGTCCA AATTCGCCCGCTTAAGTCAGGT IV. CAGTAGGATTTCTGTGTC

    asked by notasciencegal
  84. Methylene chloride

    Question: A sample was placed on a chromatography column. Methylene chloride was used as the eluting solvent. All of the components eluted off the column, but no separation was observed. What must have been happening during this experiment? How would you

    asked by Sheryl
  85. Naphthalene

    Question: You are about to purify an impure sample of naphthalene by column chromatography. What solvent should you use to elute the sample? My answer: Naphthalene is very nonpolar so a very nonpolar solvent like hexane should be used.

    asked by Sheryl
  86. science

    which is longer or farthest...millimeters centimeters....meters....or kilometers..... kilo hecto deka meter deci centi milli from top to bottom. Kilo is the largest, milli is the smallest.

    asked by chemiii
  87. A.P Chemistry

    A rigid 5.00 L cylinder contains 24.5g of N2(g) and 28.0g of O2(g). (a). Calculate the total pressure, in atm, of the gas mixture in the cylinder at 298 K (b) The temperature of the gas mixture in the cylinder is decreased to 280 K. Calculate each of the

    asked by Brianna
  88. science again

    wats the abbreviation for degrees celsius and millisecond? http://en.wikipedia.org/wiki/Celsius http://www.answers.com/topic/millisecond http://www.sengpielaudio.com/calculator-millisecond.htm

    asked by chemiii
  89. science again again

    so if i were saying i was something somethings tall.....wich would be better....meters...centimeters...or millimerter... I really doesn't matter, but say if it were a building, then meters. Distance to the tip of Africa from where you are, then kilometers.

    asked by chemiii