Saturday
October 1, 2016

Search: which reactions between HCL, AgNO3, Pb(NO3)2, H2SO4, BaCl2, CuSO4, KI, ZnSO4, Na2CO3, and K2CrO4 are double replacement

Number of results: 39,978

Chemistry
Tap water that contains Cl− at a concentration of 50 ppm is used to prepare a 0.100 mol/L AgNO3 solution. Does a precipitate form? How much? I dont know how to find out how much precipitate will form but a precipitate will form based on my calculations 50 ppm 0.0014 mol/...
May 31, 2015 by Rez

Organic Chemistry Lab
How does the allylic halide behave under SN2 and SN1 conditions? Briefly explain why the allylic halide should be able to undergo both SN2 and SN1 mechanisms. If this is any relevant to the question, we did an experiment on the SN1/SN2 reactivity of alkyl halides, using NaI in...
November 7, 2010 by Crystal

Chemistry(steps check)
I figured out the NO3- which is 0.13, I'm stuck on the Cl- I have 0.24*2-0.0416= 0.4384 but I'm being told that's wrong What mass of silver chloride can be prepared by the reaction of 160.0 mL of 0.26 M silver nitrate with 150.0 mL of 0.24 M calcium chloride? Cl ‾ NO3&#...
June 21, 2013 by Ashley

Chemistry
In the process of separating pb2+ ions from cu+2 ions as sparingly soluble iodates, what is Pb2+ concentration when Cu+2 begins to precipitate as sodium iodate is added to a solution that is initially 0.0010M Pb(NO3)2 (aq) and 0.0010M Cu(NO3)2 (aq)? I know the answer is 1.8*10...
January 29, 2015 by Anonymous

English, grammar
I need some help with this question for one of my units in world englishes please help!? Q. Argue for or against the status of 'double negation' as a 'mistake' on spoken English. I am arguing for so I agree with this status. I believe double negation in spoken English can ...
August 28, 2013 by Anonymous

mastering chemistry
A solution of volume 80.0 mL contains 16.0 mmol HCHO2 and 9.00 mmol NaCHO2. If 1.00 ml of 12 M HCl is added to this, what will be the resulting pH? (the only problem im having for this question is how to approach it, i know that by adding HCl the concentration of the CB would ...
February 28, 2009 by chma11 student

Chemistry - urgent
The following is part of a procedure for a limit test for sulphates in an NaOH sample:- Dissolve 3.0g of NaOH in 6ml of deionized water, adjust to pH 7 with HCl (approx.7.5ml) and dilute to 15ml with deionized water. Please explain how to perform this procedure. Conc HCl or 1M...
September 21, 2010 by candy

Chemistry
(NH4)2S+CuSO4=
April 22, 2013 by judy

Chemistry - Density
Automobile batteries contain sulfuric acid. Calculate the number of grams of sulfuric acid in 0.500L of battery acid if the solution has a density of 1.28g/mL and is 38% H2SO4 (small numbers) by mass? Can you please answer this for me? density = 1.28 g/mL mass of 1 L is 1.28 g...
October 5, 2006 by Tracey

Chemistry!
10.2 g of Pb(NO3)2 are dissolved in 100 mL of water, and added to 250.0 mL of a 0.250 M solution of KI. Determine the mass in grams of Pbl2 produced, and find the number of moles of the excess reagent. PLZ explain chemistry - DrBob222, Monday, December 13, 2010 at 4:30pm...
December 14, 2010 by jenni

chemistry
A 27.00mL sample of an H2SO4 solution of unknown concentration is titrated with a 0.1422M KOH solution. A volume of 40.22mL of KOH was required to reach the equivalence point. What is the concentration of the unknown H2SO4 solution? Any help would be greatly appreciated. (:
December 14, 2014 by Luis

Organic Chemistry
Hi, I did an extraction experiment. I've got my basic layer, and getting my acidic salt in return. To do this, I am instructed to first "add a small amount of NaCl to help with the product precipitation". Then, again I am instructed to add HCl to "acidify" the solution. With ...
November 3, 2014 by Juan

Science
The compound which will form the strongest dipole between CCl4;CO2;BF3;HCL;PF3
April 28, 2016 by Metse

ap chemistry
please explain titration problems. I'm a total noob at this and am trying to answer some prelab questions. Examples: 1. How many mL of a 0.800 M NaOH solution is needed to just neutralize 40 mL of a 0.600 M HCl solution? 2. You wish to determine the molarity of a solution of ...
October 2, 2008 by chris

CHEMISTRY 1
What is the correct net ionic equation, including all coefficients, charges, and phases, for the following set of reactants? Assume that the contribution of protons from H2SO4 is near 100 %. Ba(OH)2(aq)+H2SO4(aq)→ Express your answer as a chemical equation. This is what ...
October 6, 2014 by Run

Chemistry ,Reactions at Electrodes during Electrol
Reactions at Electrodes during Electrolysis Which half-reaction will take place at the cathode during the electrolysis of molten MgCl2? 2Cl- > Cl2 + 2e- Cl2 + 2e- > 2Cl- Mg2+ + 2e- > Mg Mg > Mg2+ + 2e- Which half-reaction will take place at the cathode during the ...
April 8, 2012 by Mahtab

English/Grammar help
The sentences below have transitive verbs so each verb has a direct object. Read each sentences and underline its direct object. (Underline the subject once, and double underline the action verb and circle the do.) please correct me if I'm wrong! 5. He removed the picture from...
September 6, 2014 by Anonymous

chemistry
what simple test would you use to identify the possible presence of HCl(aq)? What result do you expect if the solution is HCl(aq)?
October 16, 2008 by Lili

chemistry
Assuming that the volumes are additive , how much water should be added to75.0 mL of 6.00 M HCl to prepare 0.500 M HCl?
December 5, 2009 by Alizza

Chemistry
A 20.0-mL sample of 0.20M sodium acetate is titrated with 0.11M HCl(aq). What is the pH after the addition of 50.0-mL HCl(aq)? (Kb of CH3CO2 = 5.6x10^-10)
March 26, 2010 by Sean

chemistry
I need 500 ml of 0.10 m HCL solution. I have a 3.785 liter container of HCL at 31.45% concentration. How do I acheive my objective?
October 16, 2010 by Daniel

chemistry
What is the concentration of HCl in a 250.0 mL sample of hydrochloric acid if 15.5 mL of 0.0100 M NaOH is needed to react with all the HCl?
February 22, 2011 by Maddy

Chemistry
For the following reaction: 6ClO2 (g) + 3H2O (l) = 5HClO3 (l) + HCl (g) If a chemist wants to make 55.0 g of HCl, how much ClO2 is needed?
November 14, 2011 by Carrie

Chemistry
2 Fe (s) + 6 HCl (aq) -> 2 FeCL3 (s) + 3 H2 (g) How many liters of H2 would be formed if 200 g of Fe completely reacted with HCl at 40 degrees Celsius and 1.5 atm?
May 24, 2012 by Lily

balaji pharmacy clg ,science
why it is taken 85ml of hcl for 1 lt of solvent according to I.P. while it is 43.02ml of hcl when it is calculated?
January 13, 2013 by shaziya

balaji pharmacy clg ,science
why it is taken 85ml of hcl for 1 lt of solvent according to I.P. while it is 43.02ml of hcl when it is calculated?
January 13, 2013 by shaziya

Lone Peak High
How much of a stock (18.5 M) HCl solution would be required to make 100mL of 0.025 M HCl?
June 7, 2014 by Annie

Chemistry
How much water must be added to make 500 ml of 12.0 M HCl to 1.0 M HCl (500mL• 12M) / 1.0M =6000m Is this correct?
May 8, 2015 by Carl

Chemistry
How much water must be added to make 500 ml of 12.0 M HCl to 1.0 M HCl (500mL• 12M) / 1.0M =6000m Is this correct?
May 10, 2015 by Carl

chemistry
12M HCl + H20→ 5M HCl How much water? Total Volume= Pls I need this tomorrow
September 1, 2016 by jack

Chemistry
Can someone show and explain to me step by step how to do the problems? I feel like I am doing it incorrectly. a) The solubility of PbI2 is 3.67 mg per mL. What is the Ksp? b) Three drops of 0.20 M potassium iodide are added to 100.0 mL of 0.010 M lead nitrate. Will a ...
March 25, 2014 by Miki

chemistry
How do I prepare 10% w/v HCl from 37%(w/w) HCl (density 1.19g/ml)? Thanks.
June 22, 2009 by Carol

adult education
How many moles of HCL are in 50.0 mL of 0.600 M HCl?
July 20, 2010 by santhosh

AP Chemistry
what is the number of moles of HCl in 50mL of 1.0M HCl
December 1, 2010 by Sam

science
50 mL 3.0 M HCl(aq) that means hw much HCl . Can anybody ilaborate it
March 8, 2011 by Tumpa

Science
How do you calculate the preparation of 0.1M HCl using 33% HCl?
March 20, 2014 by Raksha

chemistry please help!!
4{C3H5(NO3)2}(l)--->6N2(g)+O2(g)+12CO2(g)+10H2O(g) If a dynamite of 100mL needs 3.5atm to explode, what minimum mass of C3H5(NO3)2 do I need to put in at 25 degree celcius? I tried to do this by finding the number of moles by the formula PV=nRT and then convert that into ...
October 22, 2008 by ashley

Chemistry
2) To the solution in problem 1 (d) at 100 degrees celsius, 10g of water are added, and the solution is cooled to 0 degrees celsius... (problem 1d: the number of grams of water required to dissolve a mixture containing 15 g KNO3 and 3.5 g CuSO4 * 5 H20, assuming that the ...
September 18, 2012 by Sam

Heat Capacity
When a 3.25 g sample of solid sodium hydroxide was dissolved in a calorimeter in 100 g of water, the temperature rose from 23.9 C to 32.0 C. Calculate delta H (in kJ/mol) of for the solution process: NaOH (s) -> Na+(aq) + OH-(aq) Use a calorimeter heat capacity of Ccal = 15...
December 18, 2012 by Jamie

CHEMISTRY FORMULA
How would you write the chemical formula for Mercury(I) nitrate. i have Hg(NO3)2 since the charge of nitrate is -2 and Mercury's is 1. However, upon checking online i found that the correct formula is Hg2(No3)2. I don't understand where the subscript 2 of Hg originated from' ...
October 17, 2010 by Moi

Chemistry
Explain the difference in bond lengths of N2, O2, and F2. Ans: I assume it's because of bond order (single, double, and triple bonds). Explain the difference in bond lengths of HF, HCl, and HBr. Ans: I'm not sure about this one???
April 14, 2009 by John Jeremy

BIO 12
BIO 12 DNA DOUBLE HELIX. Hi, I'm having troubles understanding the following question(s) and was wondering if anyone could give me a hand? Original DNA Double Helix: TACGGGATACCGCCGTTCACACGT ( Starting From Left; Position #1 would be between the first A and T, Position #2 ...
September 24, 2015 by Stephanie

3rd grade math
Double my tens digit to get my ones digit. Double me and I am less than 50. Who am I?
May 12, 2010 by Pam & Hannah

Science
How resistivty of conductor vary if area is halved,length is double,area is double
September 11, 2016 by Anonymous

Math
A bag contains 4 green marbles, 6 red marbles, and 2 white marbles. Three marbles are drawn at random with replacement. With replacement means that after a marble is drawn, it is replaced before the next one is drawn. What is the probability of not green, not red, not white?
May 18, 2012 by Junior

Chemistry
Need help with this lab: (sorry so long) Hypothesis: The amount of product will be regulated by the limiting reactant. Procedure: First, I took two test tubes from the Glassware shelf. I added 6 mL of the copper sulfate solution to one, and 6 mL of the sodium sulfide solution ...
November 14, 2009 by anonymous

chem
I am having lots of trouble with these questions: Classify each of the following reactions in as many ways as possible. (Select all that apply.) a)2 Rb(s) + Br2(g) 2 RbBr(s) you can select: -acid-base -double-displacement -gas evolution -oxidation-reduction -precipitation -...
November 29, 2010 by hannah

Chemistry
A sample of CuSO4*5H2O was heated to 110 degrees C, where it lost water and gave another hydrate of copper (II) ion that contains 32.50% Cu. A 98.77-mg sample of this new hydrate gave 116.66 mg or barium sulfate precipitate when treated with barium nitrate solution. What is ...
June 11, 2009 by Help Please!!!!!!

Chemistry
out of these conditions, which would result in fastest reaction? a. 2.0M HCL, powedered CaCO3 chip, 50 degrees celsius b. 6.0M HCL, CaCO3 chip, 25 degrees celsius c. 6.0M HCL, powdered CaCO3, 50 degrees celsius. d. 2.0M HCL, CaCO3 chip, 50 degrees celsius. Im guessing C ...
September 25, 2012 by Shreya

chemistry
What is the concentration of NaOH? using this solution (0.04756 M (i think its stand for Molarity) H2SO4) what is the concentration of NaOH in 10.00 ml of a solution, titrate to an end point using 24.22 ml of acid? formula that was given is (H2SO4 + 2NaOH --> Na2SO4 (aq) + ...
March 16, 2012 by star

chemistry
in a vessel, 0.6 mol Ba(NO3)2 and .3 mol H3PO4 are combined w deionized water to a final vol of 2 L. 3Ba(NO3)2 + 2H3PO4 --> Ba3(PO4)2 + 6HNO3 1. Calclate mass of Ba(PO4)2 formed 2. calcualate pH of HN03 3. What the concentation in mol/L of the nitrate ion after the rxn ...
March 10, 2010 by im stressed!

Physics Classical Mechanics
Consider a double star system under the influence of the gravitational force between the stars. Star 1 has mass m1 = 2.32 × 10^31 kg and Star 2 has mass m2 = 1.76 × 10^31 kg. Assume that each star undergoes uniform circular motion about the center of mass of the system (cm). ...
October 21, 2013 by Anonymous

chemistry
Suppose that 2.00mL of 0.02 mol/L aqueous sodium sulphide, Na2S is used to test a 60.0mL sample of water containing 0.0004 mol/L mecury (II) nitrate Hg(NO3)2, ions. a. Write the balanced equation Hg(NO3)2 + Na2S = HgS + 2NaNO3 b. Determine the limiting reactant Na2S = 2.00mL/...
April 8, 2015 by sharon

Chemistry - Heat Capacity
When a 3.25 g sample of solid sodium hydroxide was dissolved in a calorimeter in 100 g of water, the temperature rose from 23.9 C to 32.0 C. Calculate delta H (in kJ/mol) of for the solution process: NaOH (s) -> Na+(aq) + OH-(aq) Use a calorimeter heat capacity of Ccal = 15...
December 17, 2012 by Amy

Chemistry
We conducted a lab with antacids in class the other day and i'm having trouble doing the calculations. Well we basically took antacid tablets dissolved them in HCl, heated it and then added phenolthalien and then titrated until we saw a pink color. At 41mL we saw the pink and ...
March 15, 2010 by Anonymous

statistics
Please help asap! A tire company is considering a tire replacement company. They have agreed to replace any tire that fails with a life in the bottom 10% of the population. For a given population of tires, the life is a normal distribution with a mean of 27 months and a ...
January 18, 2011 by Going crazy

chemistry
A chemist needs a HCl solution with a molarity of less than 0.400 M for an experiment. To find out if a sample of HCl solution can be used in the lab, the chemist performs a titration to neutralize 59.2 mL of the HCl with 45 mL of 0.400 M NaOH. Based on the results, will the ...
January 31, 2014 by Matthew

Visualizing spots
Question: A colorless unknown substance is spotted on a TLC plate and developed in the correct solvent. The spots do not appear when visualization with a UV lamp or iodine vapors is attempted. What could you do to visualize the spots if the compound is the following: My answer...
October 15, 2006 by Sheryl

CHEMISTRY
Here's one last equation I can't balance: Al{subscript 2}(SO{subscript 4}){subscript 3} + ZnCl{subscript 2} -> AlCl{subscript 3} + ZnSO{subscript 4} Please help, and thanks again. Response Al2(SO4)3 + 3ZnCl2 ---> 2AlCl3 + ?___ZnSO4 Why do you have "?____" before the ZnSO4?
October 13, 2008 by Anonymous

Chemistry
please check my answers. THANK YOU. 1) The percent by mass of carbon in acetone, C3H6O is. Answer: 62.1% 2) What is the percent by mass of zinc, Zn, in ZnCO3? Answer: 52.3% 3)What is the percentage of water in the compound BaCl2 * 2H2O? Answer: 7.96% 4)How many atoms are in ...
August 1, 2007 by anonymous

chemistry
Im stuck on these few questions that seems to be getting me no where : -Determine the number of mmoles of HCl that did not react with the anatacid. c HCl = 0.1812 c NaOH = 0.1511 volume of HCl added : 75 volume of NaOH added: 29.23,19.58,33.3 - mmoles of HCl neutralized by the...
October 8, 2013 by karen

chemistry
Im stuck on these few questions that seems to be getting me no where : c HCl = 0.1812 c NaOH = 0.1511 volume of HCl added : 75 volume of NaOH added: 29.23,19.58,33.3 -Determine the number of mmoles of HCl that did not react with the anatacid. - mmoles of HCl neutralized by the...
October 8, 2013 by kathy

C
Classify each of the following by the type of solid if forms: a. LiCl b. BaCl2 c. BCl3 d. CCl4 e. NCl3
February 3, 2008 by Anonymous

Chemistry 104
How many milliliters of 0.310 M BaCl2 are needed to react completely with 60.0 mL of 0.140 M NaSO4?
November 11, 2010 by Brenna

chemistry
write the balanced chemical equation for the reaction that occurs when BaCl2.2H2O is heated.
September 11, 2011 by jess

Chemistry
How many milliliters of 0.150M BaCl2 are needed to react completely with 40.0mL of 0.260M Na2SO4?
December 12, 2014 by Ashlee

Chemistry 30
Complete the following reactions by moving only one proton at a time. Identify the acid (A) and the base (B) on the left-hand side of the equation, and the conjugate acid (CA) and the conjugate base (CB) on the right-hand side of the equation, according to Bronsted-Lowry ...
October 2, 2014 by Ade

chem
A2.27g sample of the explosive, nitroglycerin, C3H5(NO3)3, is allowed to explode in a bomb calorimeter at standard conditions. The amount of heat evolved is 15.1 kJ. This explosion of nitroglycerin occurs according to the equation: 2C3H5(NO3)3 (l)⟶6CO2 (g) + 5H2O (l) + ...
May 7, 2015 by carolin

math
Finance: if given the equation: y=12000(1.07)^x a)Estimate the time it will take to double using the rule of 72 b)determine the time it takes for the investment to double useing the fuction
January 19, 2011 by Dane

Math
Finance: if given the equation: y=12000(1.07)^x a)Estimate the time it will take to double using the rule of 72 b)determine the time it takes for the investment to double useing the fuction
January 19, 2011 by Dane

English
Identify the problem in the sentence: James's feet are longer than Steven. a.) double comparison b.) illogical comparison c.) double negative d.) incorrect degree of modifier I think it is D...?
May 19, 2015 by Cassie

Chemistry
A 23.596 g sample of aqueous waste leaving a fertilizer manufacturer contains ammonia. The sample is diluted with 79.504 g of water. A 13.803 g aliquot of this solution is then titrated with 0.1098 M HCl. It required 29.02 ml of the HCl solution to reac the methyl red endpoint...
November 14, 2011 by Mike

chemistry
A 23.596 g sample of aqueous waste leaving a fertilizer manufacturer contains ammonia. The sample is diluted with 79.504 g of water. A 13.803 g aliquot of this solution is then titrated with 0.1098 M HCl. It required 29.02 ml of the HCl solution to reac the methyl red endpoint...
November 14, 2011 by Mike

Ap Chemistry.
Zn + 2HCl -> ZnCl2 + H2 If 7.29 g of Zinc reacted, how many liters of HCl were used? I know that i can't use mass volume conversion, because the HCl is not a gas...so what do i do?
October 25, 2010 by Chris

Chemistry
By titration it is found that 76.3Ml of 0.178M of NaOH(aq) is needed to neutralize 25.00mL of HCL(aq). Calculate the concentration of the HCl solution.
April 17, 2013 by Katherine

Physical science
To investigate whether the amount of heat produced will depend on an increase on the concentration of HCL when HCL reacts with an excess Zn
April 20, 2013 by Miss p

chem
how many mL of .135M Sr(OH)2 are needed to neutralize 35ml of .157M HCL I know the answer came out to 20.4 ml My only question is how do I convert HCL to Sr(OH)2
September 29, 2013 by Alexandra

science
Hcl is titrated against 5ml of sodium carbonate of strength 0.0133 then what should be the mean value of HCl added ?
February 18, 2016 by Anonymous

chemistry
Hcl is titrated against 5ml of sodium carbonate of strength 0.0133 then what should be the mean value of HCl added ?
February 18, 2016 by Shareen

health science chemistry
How many ml of water should be added to 20.0 ml of a stock of 12.0 M HCl solution to make 1.50 M HCl ?assume that the volumes are additive.
May 4, 2016 by konja

Chemistry(please check my answer)
When the equation HCl + MnO2 → MnCl2 + H2O + Cl2 is balanced, what is the coefficient for HCl? A. 1 B. 2 C. 3 D. 4***
September 1, 2016 by Cherry

Chemistry Check
The Synthesis of hydrogen chloride is written H2+Cl2==>2HCl. 3L of hydrogen are used and all gasses are at STP. The volume of HCL produced in the reaction would be _______ L. would the answer be 5.96? Three liters of H2 yields six liters of HCl, from the balanced equation. ...
January 19, 2007 by Briana

Chemistry
When titrating 50.0 mL of 0.10 M H2SO4 with 0.10 M NaOH, how many mL of NaOH will you have added to reach the 1st equivalence point? I am confused... What H2A problem? Chemistry-Dr.Bob222 - DrBob222, Tuesday, April 12, 2016 at 1:49am Refer to the H2A problem above BUT you only...
April 12, 2016 by Nevaeh

Chemistry
I am pretty good at balancing oxidation reduction problems, but I can't do this one: HIO3 + FeI2 + HCL -> FeCl3 + ICl + HOH 5HIO3 + 4FeI2 + 25HCl -> 4FeCl3 + 13ICl + 15HOH I separated the three redox equations, added the two oxidation reactions together, then balanced ...
February 2, 2007 by Brendan

chem
Describe in detail by words how to prepare 200ml of .150M HCl from a 1.00 M HCl stock solution? Need help with this please? i used C1V1=C2V2 and got volume 2 = 33L or 0.33mL. to prepare the solution i need to weigh 1 gram of HCL (from 1.00M HCl stock solution)lets say i put it...
November 27, 2012 by vince11

Chem
Which coordination compound will most likely form a precipitate when treated with silver(II) nitrate (aqueous)? [Cr(NH3)3Cl3] [Cr(NH3)6Cl3] Na3[Cr(CN)6] Na3[CrCl6] I tried the solubility rules, but that didn't work out. Any help would be great. I made a mistake about, it's ...
April 21, 2007 by Londy

Chemistry
1. What is the molar of a sodium bicarbonate solution prepared from 150 g of NaHCO3 in 150 mL solution? 2. What mass of glucose (C6H12O6) is needed to prepare a solution of 10 M, 5 L solution? 3. What volume in liters of a 4.0 M Ca(NO3)2 is needed to provide 50 g Ca(NO3)2?
May 4, 2015 by Anonymous

Chemistry
4. Use the information above to write net ionic equations for the two reactions that you have observed. 5. For each reaction, write the two half-reactions that make it up and calculate the overall reaction potential by adding the two half-reactions. Each overall potential ...
April 8, 2012 by Please Check!

Chemistry
Sorry DrBob22, I wasn't sure if you saw my last post. But, I am still a little confused. Here's the info: Antacid Brand: Life Concentration of HCl: 0.1845 M Concentration of NaOH: 0.1482 M Trial 1: 1.Mass of Table: 1.2173g 2.Volume of HCl added: 75.0 mL 3.Milliomoles of HCl ...
October 18, 2010 by Akhed-To DrBob222

chem
Which of the following pairs of substances, when mixed in any proportion you wish, can be used to prepare a buffer solution? (Select all that apply.) NaCN and HCN NaCN and NaOH HCN and NaOH HCl and NaCN HCl and NaOH and Which of the following gives a buffer solution when equal...
April 12, 2011 by Rebekah

chemistry
how do you balance CuSO4* 5H2O
January 29, 2011 by dasia

chemistry
Preceed the equation of CuSO4 + Fe
February 18, 2013 by kim

Chemistry
The problem asked to find the amount (in moles) of reactant left. .223moles FeS and .652moles of HCl FeS+2HCl--> FeCl2+H2S .223molFeS(1moleFeCl2/1moleFeS)=.223moleFeCl2 .652molHCl(1moleFeCl2/2molHCl)=.326moleFeCl2 .223/.326x100=68.4% used HCL 100-68.4=31.6% remaining 31.6%x...
February 25, 2014 by G.C.

Chemistry
The problem asked to find the amount (in moles) of reactant left. .223moles FeS and .652moles of HCl FeS+2HCl--> FeCl2+H2S .223molFeS(1moleFeCl2/1moleFeS)=.223moleFeCl2 .652molHCl(1moleFeCl2/2molHCl)=.326moleFeCl2 .223/.326x100=68.4% used HCL 100-68.4=31.6% remaining 31.6%x...
February 25, 2014 by G.C.

Chemistry
The problem asked to find the amount (in moles) of reactant left. .223moles FeS and .652moles of HCl FeS+2HCl--> FeCl2+H2S .223molFeS(1moleFeCl2/1moleFeS)=.223moleFeCl2 .652molHCl(1moleFeCl2/2molHCl)=.326moleFeCl2 .223/.326x100=68.4% used HCL 100-68.4=31.6% remaining 31.6%x...
February 25, 2014 by G.C.

Chemistry
How many moles of sodium chloride must be added to an aqueous solution that contains 2.0 moles of silver nitrate in order to precipitate 0.50 moles of silver chloride? A) 0.25 mol B) 0.50 mol C) 1.0 mol D) 2.0 mol E) 1.5 mol The answer is B. I have no idea what to do. I was ...
March 22, 2009 by Jill

chemistry
Given the following reaction: Pd(NO3)2+CaSO4-->PdSO4+Ca(NO3)2 If you started with 225.6ml of 6.32M CaSO4 and the percent yield of this reaction was ol 78.2%, what is the actual yield of grams mod of PdSO4?
December 4, 2010 by regina

statistics
Suppose you sample randomly, without replacement, a number between 1 and 999999, all outcomes have the same probability of being selected.What is the probability that the digits of the number selected add up to 23
September 14, 2010 by cebile

chemistry
why would a polystyrene cup be used in an exothermic reaction between HCl and NaOH instead of a beaker?
May 3, 2011 by Betsie

chemistry
The reaction of aqueous cobalt(II) iodide and aqueous lead(II) nitrate is represented by the balanced formula equation. CoI2(aq) + Pb(NO3)2(aq) → PbI2(s) + Co(NO3)2(aq) Give the balanced ionic equation for the reaction. Include the states.
January 20, 2010 by bubble

  1. Pages:
  2. <<Prev
  3. 14
  4. 15
  5. 16
  6. 17
  7. 18
  8. 19
  9. 20
  10. 21
  11. 22
  12. 23
  13. 24
  14. 25
  15. 26
  16. 27
  17. 28
  18. Next>>