August 26, 2016

Search: which reactions between HCL, AgNO3, Pb(NO3)2, H2SO4, BaCl2, CuSO4, KI, ZnSO4, Na2CO3, and K2CrO4 are double replacement

Number of results: 39,605

10.2 g of Pb(NO3)2 are dissolved in 100 mL of water, and added to 250.0 mL of a 0.250 M solution of KI. Determine the mass in grams of Pbl2 produced, and find the number of moles of the excess reagent. PLZ explain chemistry - DrBob222, Monday, December 13, 2010 at 4:30pm...
December 14, 2010 by jenni

A 27.00mL sample of an H2SO4 solution of unknown concentration is titrated with a 0.1422M KOH solution. A volume of 40.22mL of KOH was required to reach the equivalence point. What is the concentration of the unknown H2SO4 solution? Any help would be greatly appreciated. (:
December 14, 2014 by Luis

English/Grammar help
The sentences below have transitive verbs so each verb has a direct object. Read each sentences and underline its direct object. (Underline the subject once, and double underline the action verb and circle the do.) please correct me if I'm wrong! 5. He removed the picture from...
September 6, 2014 by Anonymous

ap chemistry
please explain titration problems. I'm a total noob at this and am trying to answer some prelab questions. Examples: 1. How many mL of a 0.800 M NaOH solution is needed to just neutralize 40 mL of a 0.600 M HCl solution? 2. You wish to determine the molarity of a solution of ...
October 2, 2008 by chris

2) To the solution in problem 1 (d) at 100 degrees celsius, 10g of water are added, and the solution is cooled to 0 degrees celsius... (problem 1d: the number of grams of water required to dissolve a mixture containing 15 g KNO3 and 3.5 g CuSO4 * 5 H20, assuming that the ...
September 18, 2012 by Sam

Heat Capacity
When a 3.25 g sample of solid sodium hydroxide was dissolved in a calorimeter in 100 g of water, the temperature rose from 23.9 C to 32.0 C. Calculate delta H (in kJ/mol) of for the solution process: NaOH (s) -> Na+(aq) + OH-(aq) Use a calorimeter heat capacity of Ccal = 15...
December 18, 2012 by Jamie

A sample of CuSO4*5H2O was heated to 110 degrees C, where it lost water and gave another hydrate of copper (II) ion that contains 32.50% Cu. A 98.77-mg sample of this new hydrate gave 116.66 mg or barium sulfate precipitate when treated with barium nitrate solution. What is ...
June 11, 2009 by Help Please!!!!!!

what simple test would you use to identify the possible presence of HCl(aq)? What result do you expect if the solution is HCl(aq)?
October 16, 2008 by Lili

Assuming that the volumes are additive , how much water should be added to75.0 mL of 6.00 M HCl to prepare 0.500 M HCl?
December 5, 2009 by Alizza

A 20.0-mL sample of 0.20M sodium acetate is titrated with 0.11M HCl(aq). What is the pH after the addition of 50.0-mL HCl(aq)? (Kb of CH3CO2 = 5.6x10^-10)
March 26, 2010 by Sean

I need 500 ml of 0.10 m HCL solution. I have a 3.785 liter container of HCL at 31.45% concentration. How do I acheive my objective?
October 16, 2010 by Daniel

What is the concentration of HCl in a 250.0 mL sample of hydrochloric acid if 15.5 mL of 0.0100 M NaOH is needed to react with all the HCl?
February 22, 2011 by Maddy

For the following reaction: 6ClO2 (g) + 3H2O (l) = 5HClO3 (l) + HCl (g) If a chemist wants to make 55.0 g of HCl, how much ClO2 is needed?
November 14, 2011 by Carrie

2 Fe (s) + 6 HCl (aq) -> 2 FeCL3 (s) + 3 H2 (g) How many liters of H2 would be formed if 200 g of Fe completely reacted with HCl at 40 degrees Celsius and 1.5 atm?
May 24, 2012 by Lily

balaji pharmacy clg ,science
why it is taken 85ml of hcl for 1 lt of solvent according to I.P. while it is 43.02ml of hcl when it is calculated?
January 13, 2013 by shaziya

balaji pharmacy clg ,science
why it is taken 85ml of hcl for 1 lt of solvent according to I.P. while it is 43.02ml of hcl when it is calculated?
January 13, 2013 by shaziya

Lone Peak High
How much of a stock (18.5 M) HCl solution would be required to make 100mL of 0.025 M HCl?
June 7, 2014 by Annie

How much water must be added to make 500 ml of 12.0 M HCl to 1.0 M HCl (500mL• 12M) / 1.0M =6000m Is this correct?
May 8, 2015 by Carl

How much water must be added to make 500 ml of 12.0 M HCl to 1.0 M HCl (500mL• 12M) / 1.0M =6000m Is this correct?
May 10, 2015 by Carl

BIO 12
BIO 12 DNA DOUBLE HELIX. Hi, I'm having troubles understanding the following question(s) and was wondering if anyone could give me a hand? Original DNA Double Helix: TACGGGATACCGCCGTTCACACGT ( Starting From Left; Position #1 would be between the first A and T, Position #2 ...
September 24, 2015 by Stephanie

What is the correct net ionic equation, including all coefficients, charges, and phases, for the following set of reactants? Assume that the contribution of protons from H2SO4 is near 100 %. Ba(OH)2(aq)+H2SO4(aq)→ Express your answer as a chemical equation. This is what ...
October 6, 2014 by Run

Chemistry ,Reactions at Electrodes during Electrol
Reactions at Electrodes during Electrolysis Which half-reaction will take place at the cathode during the electrolysis of molten MgCl2? 2Cl- > Cl2 + 2e- Cl2 + 2e- > 2Cl- Mg2+ + 2e- > Mg Mg > Mg2+ + 2e- Which half-reaction will take place at the cathode during the ...
April 8, 2012 by Mahtab

Explain the difference in bond lengths of N2, O2, and F2. Ans: I assume it's because of bond order (single, double, and triple bonds). Explain the difference in bond lengths of HF, HCl, and HBr. Ans: I'm not sure about this one???
April 14, 2009 by John Jeremy

3rd grade math
Double my tens digit to get my ones digit. Double me and I am less than 50. Who am I?
May 12, 2010 by Pam & Hannah

How do I prepare 10% w/v HCl from 37%(w/w) HCl (density 1.19g/ml)? Thanks.
June 22, 2009 by Carol

adult education
How many moles of HCL are in 50.0 mL of 0.600 M HCl?
July 20, 2010 by santhosh

AP Chemistry
what is the number of moles of HCl in 50mL of 1.0M HCl
December 1, 2010 by Sam

50 mL 3.0 M HCl(aq) that means hw much HCl . Can anybody ilaborate it
March 8, 2011 by Tumpa

How do you calculate the preparation of 0.1M HCl using 33% HCl?
March 20, 2014 by Raksha

Can someone show and explain to me step by step how to do the problems? I feel like I am doing it incorrectly. a) The solubility of PbI2 is 3.67 mg per mL. What is the Ksp? b) Three drops of 0.20 M potassium iodide are added to 100.0 mL of 0.010 M lead nitrate. Will a ...
March 25, 2014 by Miki

chemistry please help!!
4{C3H5(NO3)2}(l)--->6N2(g)+O2(g)+12CO2(g)+10H2O(g) If a dynamite of 100mL needs 3.5atm to explode, what minimum mass of C3H5(NO3)2 do I need to put in at 25 degree celcius? I tried to do this by finding the number of moles by the formula PV=nRT and then convert that into ...
October 22, 2008 by ashley

Chemistry - Heat Capacity
When a 3.25 g sample of solid sodium hydroxide was dissolved in a calorimeter in 100 g of water, the temperature rose from 23.9 C to 32.0 C. Calculate delta H (in kJ/mol) of for the solution process: NaOH (s) -> Na+(aq) + OH-(aq) Use a calorimeter heat capacity of Ccal = 15...
December 17, 2012 by Amy

I am having lots of trouble with these questions: Classify each of the following reactions in as many ways as possible. (Select all that apply.) a)2 Rb(s) + Br2(g) 2 RbBr(s) you can select: -acid-base -double-displacement -gas evolution -oxidation-reduction -precipitation -...
November 29, 2010 by hannah

How would you write the chemical formula for Mercury(I) nitrate. i have Hg(NO3)2 since the charge of nitrate is -2 and Mercury's is 1. However, upon checking online i found that the correct formula is Hg2(No3)2. I don't understand where the subscript 2 of Hg originated from' ...
October 17, 2010 by Moi

Need help with this lab: (sorry so long) Hypothesis: The amount of product will be regulated by the limiting reactant. Procedure: First, I took two test tubes from the Glassware shelf. I added 6 mL of the copper sulfate solution to one, and 6 mL of the sodium sulfide solution ...
November 14, 2009 by anonymous

Physics Classical Mechanics
Consider a double star system under the influence of the gravitational force between the stars. Star 1 has mass m1 = 2.32 × 10^31 kg and Star 2 has mass m2 = 1.76 × 10^31 kg. Assume that each star undergoes uniform circular motion about the center of mass of the system (cm). ...
October 21, 2013 by Anonymous

out of these conditions, which would result in fastest reaction? a. 2.0M HCL, powedered CaCO3 chip, 50 degrees celsius b. 6.0M HCL, CaCO3 chip, 25 degrees celsius c. 6.0M HCL, powdered CaCO3, 50 degrees celsius. d. 2.0M HCL, CaCO3 chip, 50 degrees celsius. Im guessing C ...
September 25, 2012 by Shreya

A bag contains 4 green marbles, 6 red marbles, and 2 white marbles. Three marbles are drawn at random with replacement. With replacement means that after a marble is drawn, it is replaced before the next one is drawn. What is the probability of not green, not red, not white?
May 18, 2012 by Junior

What is the concentration of NaOH? using this solution (0.04756 M (i think its stand for Molarity) H2SO4) what is the concentration of NaOH in 10.00 ml of a solution, titrate to an end point using 24.22 ml of acid? formula that was given is (H2SO4 + 2NaOH --> Na2SO4 (aq) + ...
March 16, 2012 by star

in a vessel, 0.6 mol Ba(NO3)2 and .3 mol H3PO4 are combined w deionized water to a final vol of 2 L. 3Ba(NO3)2 + 2H3PO4 --> Ba3(PO4)2 + 6HNO3 1. Calclate mass of Ba(PO4)2 formed 2. calcualate pH of HN03 3. What the concentation in mol/L of the nitrate ion after the rxn ...
March 10, 2010 by im stressed!

Suppose that 2.00mL of 0.02 mol/L aqueous sodium sulphide, Na2S is used to test a 60.0mL sample of water containing 0.0004 mol/L mecury (II) nitrate Hg(NO3)2, ions. a. Write the balanced equation Hg(NO3)2 + Na2S = HgS + 2NaNO3 b. Determine the limiting reactant Na2S = 2.00mL/...
April 8, 2015 by sharon

We conducted a lab with antacids in class the other day and i'm having trouble doing the calculations. Well we basically took antacid tablets dissolved them in HCl, heated it and then added phenolthalien and then titrated until we saw a pink color. At 41mL we saw the pink and ...
March 15, 2010 by Anonymous

A chemist needs a HCl solution with a molarity of less than 0.400 M for an experiment. To find out if a sample of HCl solution can be used in the lab, the chemist performs a titration to neutralize 59.2 mL of the HCl with 45 mL of 0.400 M NaOH. Based on the results, will the ...
January 31, 2014 by Matthew

Please help asap! A tire company is considering a tire replacement company. They have agreed to replace any tire that fails with a life in the bottom 10% of the population. For a given population of tires, the life is a normal distribution with a mean of 27 months and a ...
January 18, 2011 by Going crazy

Im stuck on these few questions that seems to be getting me no where : -Determine the number of mmoles of HCl that did not react with the anatacid. c HCl = 0.1812 c NaOH = 0.1511 volume of HCl added : 75 volume of NaOH added: 29.23,19.58,33.3 - mmoles of HCl neutralized by the...
October 8, 2013 by karen

Im stuck on these few questions that seems to be getting me no where : c HCl = 0.1812 c NaOH = 0.1511 volume of HCl added : 75 volume of NaOH added: 29.23,19.58,33.3 -Determine the number of mmoles of HCl that did not react with the anatacid. - mmoles of HCl neutralized by the...
October 8, 2013 by kathy

Visualizing spots
Question: A colorless unknown substance is spotted on a TLC plate and developed in the correct solvent. The spots do not appear when visualization with a UV lamp or iodine vapors is attempted. What could you do to visualize the spots if the compound is the following: My answer...
October 15, 2006 by Sheryl

Here's one last equation I can't balance: Al{subscript 2}(SO{subscript 4}){subscript 3} + ZnCl{subscript 2} -> AlCl{subscript 3} + ZnSO{subscript 4} Please help, and thanks again. Response Al2(SO4)3 + 3ZnCl2 ---> 2AlCl3 + ?___ZnSO4 Why do you have "?____" before the ZnSO4?
October 13, 2008 by Anonymous

Finance: if given the equation: y=12000(1.07)^x a)Estimate the time it will take to double using the rule of 72 b)determine the time it takes for the investment to double useing the fuction
January 19, 2011 by Dane

Finance: if given the equation: y=12000(1.07)^x a)Estimate the time it will take to double using the rule of 72 b)determine the time it takes for the investment to double useing the fuction
January 19, 2011 by Dane

Identify the problem in the sentence: James's feet are longer than Steven. a.) double comparison b.) illogical comparison c.) double negative d.) incorrect degree of modifier I think it is D...?
May 19, 2015 by Cassie

Chemistry 30
Complete the following reactions by moving only one proton at a time. Identify the acid (A) and the base (B) on the left-hand side of the equation, and the conjugate acid (CA) and the conjugate base (CB) on the right-hand side of the equation, according to Bronsted-Lowry ...
October 2, 2014 by Ade

please check my answers. THANK YOU. 1) The percent by mass of carbon in acetone, C3H6O is. Answer: 62.1% 2) What is the percent by mass of zinc, Zn, in ZnCO3? Answer: 52.3% 3)What is the percentage of water in the compound BaCl2 * 2H2O? Answer: 7.96% 4)How many atoms are in ...
August 1, 2007 by anonymous

Classify each of the following by the type of solid if forms: a. LiCl b. BaCl2 c. BCl3 d. CCl4 e. NCl3
February 3, 2008 by Anonymous

Chemistry 104
How many milliliters of 0.310 M BaCl2 are needed to react completely with 60.0 mL of 0.140 M NaSO4?
November 11, 2010 by Brenna

write the balanced chemical equation for the reaction that occurs when BaCl2.2H2O is heated.
September 11, 2011 by jess

How many milliliters of 0.150M BaCl2 are needed to react completely with 40.0mL of 0.260M Na2SO4?
December 12, 2014 by Ashlee

A2.27g sample of the explosive, nitroglycerin, C3H5(NO3)3, is allowed to explode in a bomb calorimeter at standard conditions. The amount of heat evolved is 15.1 kJ. This explosion of nitroglycerin occurs according to the equation: 2C3H5(NO3)3 (l)⟶6CO2 (g) + 5H2O (l) + ...
May 7, 2015 by carolin

A 23.596 g sample of aqueous waste leaving a fertilizer manufacturer contains ammonia. The sample is diluted with 79.504 g of water. A 13.803 g aliquot of this solution is then titrated with 0.1098 M HCl. It required 29.02 ml of the HCl solution to reac the methyl red endpoint...
November 14, 2011 by Mike

A 23.596 g sample of aqueous waste leaving a fertilizer manufacturer contains ammonia. The sample is diluted with 79.504 g of water. A 13.803 g aliquot of this solution is then titrated with 0.1098 M HCl. It required 29.02 ml of the HCl solution to reac the methyl red endpoint...
November 14, 2011 by Mike

Ap Chemistry.
Zn + 2HCl -> ZnCl2 + H2 If 7.29 g of Zinc reacted, how many liters of HCl were used? I know that i can't use mass volume conversion, because the HCl is not a what do i do?
October 25, 2010 by Chris

By titration it is found that 76.3Ml of 0.178M of NaOH(aq) is needed to neutralize 25.00mL of HCL(aq). Calculate the concentration of the HCl solution.
April 17, 2013 by Katherine

Physical science
To investigate whether the amount of heat produced will depend on an increase on the concentration of HCL when HCL reacts with an excess Zn
April 20, 2013 by Miss p

how many mL of .135M Sr(OH)2 are needed to neutralize 35ml of .157M HCL I know the answer came out to 20.4 ml My only question is how do I convert HCL to Sr(OH)2
September 29, 2013 by Alexandra

Hcl is titrated against 5ml of sodium carbonate of strength 0.0133 then what should be the mean value of HCl added ?
February 18, 2016 by Anonymous

Hcl is titrated against 5ml of sodium carbonate of strength 0.0133 then what should be the mean value of HCl added ?
February 18, 2016 by Shareen

health science chemistry
How many ml of water should be added to 20.0 ml of a stock of 12.0 M HCl solution to make 1.50 M HCl ?assume that the volumes are additive.
May 4, 2016 by konja

Chemistry Check
The Synthesis of hydrogen chloride is written H2+Cl2==>2HCl. 3L of hydrogen are used and all gasses are at STP. The volume of HCL produced in the reaction would be _______ L. would the answer be 5.96? Three liters of H2 yields six liters of HCl, from the balanced equation. ...
January 19, 2007 by Briana

I am pretty good at balancing oxidation reduction problems, but I can't do this one: HIO3 + FeI2 + HCL -> FeCl3 + ICl + HOH 5HIO3 + 4FeI2 + 25HCl -> 4FeCl3 + 13ICl + 15HOH I separated the three redox equations, added the two oxidation reactions together, then balanced ...
February 2, 2007 by Brendan

how do you balance CuSO4* 5H2O
January 29, 2011 by dasia

Preceed the equation of CuSO4 + Fe
February 18, 2013 by kim

When titrating 50.0 mL of 0.10 M H2SO4 with 0.10 M NaOH, how many mL of NaOH will you have added to reach the 1st equivalence point? I am confused... What H2A problem? Chemistry-Dr.Bob222 - DrBob222, Tuesday, April 12, 2016 at 1:49am Refer to the H2A problem above BUT you only...
April 12, 2016 by Nevaeh

Describe in detail by words how to prepare 200ml of .150M HCl from a 1.00 M HCl stock solution? Need help with this please? i used C1V1=C2V2 and got volume 2 = 33L or 0.33mL. to prepare the solution i need to weigh 1 gram of HCL (from 1.00M HCl stock solution)lets say i put it...
November 27, 2012 by vince11

Which coordination compound will most likely form a precipitate when treated with silver(II) nitrate (aqueous)? [Cr(NH3)3Cl3] [Cr(NH3)6Cl3] Na3[Cr(CN)6] Na3[CrCl6] I tried the solubility rules, but that didn't work out. Any help would be great. I made a mistake about, it's ...
April 21, 2007 by Londy

Sorry DrBob22, I wasn't sure if you saw my last post. But, I am still a little confused. Here's the info: Antacid Brand: Life Concentration of HCl: 0.1845 M Concentration of NaOH: 0.1482 M Trial 1: 1.Mass of Table: 1.2173g 2.Volume of HCl added: 75.0 mL 3.Milliomoles of HCl ...
October 18, 2010 by Akhed-To DrBob222

Which of the following pairs of substances, when mixed in any proportion you wish, can be used to prepare a buffer solution? (Select all that apply.) NaCN and HCN NaCN and NaOH HCN and NaOH HCl and NaCN HCl and NaOH and Which of the following gives a buffer solution when equal...
April 12, 2011 by Rebekah

Here are some more sentences I'd like you to revise. 1) Several symbols are used to explore the theme of the double. The setting of the novel is ambivalent since it seems to be halfway between England and Scotland, London and Edinburgh. 2.Both capitals have a double nature as ...
March 14, 2011 by Franco

4. Use the information above to write net ionic equations for the two reactions that you have observed. 5. For each reaction, write the two half-reactions that make it up and calculate the overall reaction potential by adding the two half-reactions. Each overall potential ...
April 8, 2012 by Please Check!

1. What is the molar of a sodium bicarbonate solution prepared from 150 g of NaHCO3 in 150 mL solution? 2. What mass of glucose (C6H12O6) is needed to prepare a solution of 10 M, 5 L solution? 3. What volume in liters of a 4.0 M Ca(NO3)2 is needed to provide 50 g Ca(NO3)2?
May 4, 2015 by Anonymous

The problem asked to find the amount (in moles) of reactant left. .223moles FeS and .652moles of HCl FeS+2HCl--> FeCl2+H2S .223molFeS(1moleFeCl2/1moleFeS)=.223moleFeCl2 .652molHCl(1moleFeCl2/2molHCl)=.326moleFeCl2 .223/.326x100=68.4% used HCL 100-68.4=31.6% remaining 31.6%x...
February 25, 2014 by G.C.

The problem asked to find the amount (in moles) of reactant left. .223moles FeS and .652moles of HCl FeS+2HCl--> FeCl2+H2S .223molFeS(1moleFeCl2/1moleFeS)=.223moleFeCl2 .652molHCl(1moleFeCl2/2molHCl)=.326moleFeCl2 .223/.326x100=68.4% used HCL 100-68.4=31.6% remaining 31.6%x...
February 25, 2014 by G.C.

The problem asked to find the amount (in moles) of reactant left. .223moles FeS and .652moles of HCl FeS+2HCl--> FeCl2+H2S .223molFeS(1moleFeCl2/1moleFeS)=.223moleFeCl2 .652molHCl(1moleFeCl2/2molHCl)=.326moleFeCl2 .223/.326x100=68.4% used HCL 100-68.4=31.6% remaining 31.6%x...
February 25, 2014 by G.C.

Science - Pls Help! Thanks ' (:
normal double glazing windows is made from two layers of glass with air trapped in between them. So How Can They Keep The House Warm ??
January 11, 2009 by fern

why would a polystyrene cup be used in an exothermic reaction between HCl and NaOH instead of a beaker?
May 3, 2011 by Betsie

Suppose you sample randomly, without replacement, a number between 1 and 999999, all outcomes have the same probability of being selected.What is the probability that the digits of the number selected add up to 23
September 14, 2010 by cebile

How many moles of sodium chloride must be added to an aqueous solution that contains 2.0 moles of silver nitrate in order to precipitate 0.50 moles of silver chloride? A) 0.25 mol B) 0.50 mol C) 1.0 mol D) 2.0 mol E) 1.5 mol The answer is B. I have no idea what to do. I was ...
March 22, 2009 by Jill

Given the following reaction: Pd(NO3)2+CaSO4-->PdSO4+Ca(NO3)2 If you started with 225.6ml of 6.32M CaSO4 and the percent yield of this reaction was ol 78.2%, what is the actual yield of grams mod of PdSO4?
December 4, 2010 by regina

Consider a solution of CaCl2 and Mg(NO3)2 in which the concentrations of both Mg2+ and Ca2+ are the same, 0.01. M. Is it possible to separate Ca2+ from Mg2+ by selective precipitation of Mg(OH)2? To be precise, is it possible to precipitate 99.99% of magnesium without ...
October 21, 2014 by Meera

The reaction of aqueous cobalt(II) iodide and aqueous lead(II) nitrate is represented by the balanced formula equation. CoI2(aq) + Pb(NO3)2(aq) → PbI2(s) + Co(NO3)2(aq) Give the balanced ionic equation for the reaction. Include the states.
January 20, 2010 by bubble

A student mixes 5 mL of 2.00 x 10^-3 M Fe(NO3)3 with 5 mL 2.00 x 10 ^-3 M KSCN. They find that in the equilibrium mixture concentration of FeSCN^2+ is 1.40 x 10^-4 M. Find each of the following: the initial concentration in solution for Fe^3+ and SCN, the equilibrium constant ...
October 14, 2015 by Grant

English check
The sentences below have transitive verbs so each verb has a direct object. Read each sentences and underline its direct object. (Underline the subject once, and double underline the action verb and circle the do.) *** Some may not have DO*** please correct me if I'm wrong! 1...
September 7, 2014 by Anonymous

Label each of the following reactions as exothermic or endothermic ("exo" or "endo"), and according to whether work is done on or by the system, or no work is done at all ("on", "by" or "none")? Note that no "endo-on" cases appear here, as these are always thermodynamically ...
November 22, 2009 by victor

Double my tens digit to get my ones digit. Double me and I am less than fifty.
March 28, 2011 by jack

riddle:double my tens digit to get my ones digit. double me and i am less than 50.
March 17, 2011 by jan

Hi. I'm not sure if my strategy for this problem is correct: How many grams of CaCO3 will dissolve in 3.0x10^-2 mL of 0.050M Ca(NO3)2? I think I'm supposed to convert molarity of Ca(NO3)2 into moles, but then i don't know how to get from mols of that to mols of it a ...
May 17, 2008 by Amir

A volume of 10cm^3 of 2M H2SO4 is placed in a volumetric flas of 250cm^3 and filled to the mark with distilled water. What is the molar conc. of the H2So4 in the flask? After I found how many moles there are in 10cm^3, which is 0.02 mol, what is my next step, as because the ...
December 30, 2012 by Matt

Earl N. Meyer found that it took 26.54 mL of a 0.0100 M KOH solution to reach the equivalence point for the titration of 25.00 mL of HCL. What is the molarity of the HCL?
June 21, 2010 by Alisha

Chemistry :(
Calculate the molality, % percent composition by weight, and the mole fraction of HCl in an aqueous 12M HCl solution that has a density of 1.20 g?mL Please help :(
January 22, 2013 by Jillian

After 2.02 g of Al has reacted completely with 0.400 L of 2.75 M HCl (the excess reactant), what is the molarity of the remaining HCl? 2Al(s)+6HCl(aq)-->2AlCl3(aq)+3H2(g)
March 24, 2011 by Alex

When performing a titration, 23.65 mL of 1.25 M calcium carbonste was used to neutralize 9.68 mL of HCl. What is the concentration of the HCl solution? (Create a balanced equation first)
June 3, 2011 by lexi

  1. Pages:
  2. <<Prev
  3. 14
  4. 15
  5. 16
  6. 17
  7. 18
  8. 19
  9. 20
  10. 21
  11. 22
  12. 23
  13. 24
  14. 25
  15. 26
  16. 27
  17. 28
  18. Next>>