Saturday
December 3, 2016

Search: which reactions between HCL, AgNO3, Pb(NO3)2, H2SO4, BaCl2, CuSO4, KI, ZnSO4, Na2CO3, and K2CrO4 are double replacement

Number of results: 40,778

Chemistry
What is the freezing point (°C) of a solution prepared by dissolving 11.3 g of Ca(NO3)2 in 115 g of water? The molal freezing point depression constant for water is 1.86°C/m. (Note that when Ca(NO3)2 dissolves in water Ca2+ and NO32- ions are produced).
May 25, 2012 by Henry

Fundamental Chemistry
Given the balanced reaction below; write out the balanced ionic equation and the balanced net ionic equation. Include phase labels and charges where appropriate. Cu(s) + Zn(NO3)2 (aq) → Cu(NO3)2 (aq) + Zn(s)
April 13, 2016 by Dana

Chemistry
Suppose we have a solution of lead nitrate, Pb(NO3). A solution of NaCl(aq) is added slowly until no further precipitation occurs. The precipitate is collected by filtration, dried and weighed. A total of 10.27g of PbCl2(s) is obtained from 200.0mL of the original solution. ...
April 17, 2013 by Katherine

chemisrty
what is the strongest acid here? H2SO3 H2SO4 H2SeO3 H2SeO4 For oxyacids, the acidity increases with increasing number of oxygen atoms; therefore, H2SO3 and H2SeO3 will be weaker than either H2SO4 or H2SeO4. We have a problem determining which is the stronger of H2SO4 or H2SeO4...
April 30, 2007 by luis

Dr.Bob222
this is all my work so far on the limiting reagent problem I asked about yesterday about Calcium nitrate and ammonium fluoride.... 28.42g/164.1= .17318 mol Ca(NO3)2 29.6g/37.042=.79909 mol (NH4)F (1mol Ca(NO3)2 /.17318) x (2mol (NH4)F/x)=.34636 (2 mol (NH4)F/.79909)x(1 mol Ca(...
October 27, 2009 by Brittany

science
50 ml of ZnSO4 solution was transferred to a mercury cathode and enough solid potassium nitrate is added to make the solution 0.1 M in KNO3. The electrolysis of Zn2+ is carried to completion of -1.3 V vs. SCE with the passage of 241 C of electricity. calculate the initial ...
November 5, 2012 by Maya

science
50 ml of ZnSO4 solution was transferred to a mercury cathode and enough solid potassium nitrate is added to make the solution 0.1 M in KNO3. The electrolysis of Zn2+ is carried to completion of -1.3 V vs. SCE with the passage of 241 C of electricity. calculate the initial ...
November 5, 2012 by Maya

chemistry
How many milliliters of 3.6 M HCl must be transfered from a reagent bottle to provide 20 g HCl for a reaction? Answer in units of mL
August 30, 2011 by Liz

math,chemistry
How much water should be added to 1 liter of 0.12N HCl to prepare exactly 0.1N HCl?
August 23, 2010 by jc

Chemistry
How many grams of HCl are produced according to the following equation, H2 + Cl2 = 2 HCl, when 4.0 g of hydrogen reacts completely?
October 25, 2010 by Bill

Chemistry
By titration it is found that 68.9 mL of 0.122 M NaOH(aq) is needed to neutralize 25.0 mL of HCl(aq). Calculate the concentration of the HCl solution.
November 22, 2010 by Jason

chemistry
How much water would you add to 12 M HCl to make 650 mL of 1.5 M HCl? Hint: This is a dilution problem
December 14, 2010 by Nathan

chemistry
A 25 mL solution of .5M NaOH is titrated until neutralization into a 50mL sample of HCl. What was the concentration of HCl?
February 22, 2011 by E

chemistry
How many milliliters of 1.4 M HCl must be transfered from a reagent bottle to provide 23 g HCl for a reaction? Answer in units of mL
September 11, 2011 by julie

Chem
How many milliliters of 1.5 M HCl must be transfered from a reagent bottle to provide 25 g HCl for a reaction? Answer in units of mL.
September 11, 2011 by Chandler

Chemistry
How many milliliters of 5.2 M HCl must be transfered from a reagent bottle to provide 22 g HCl for a reaction? Answer in units of mL
September 15, 2011 by Anonymous

chemistry
Calculate the mass of HCl required to prepare 2.5 liters of a 0.08 molar solution of HCl. H 1.01 Hydrogen 17 Cl 35.45 Chlorine
September 26, 2011 by archie

chemistry
How many grams of HCl are produced according to the following equation, H2 + Cl2 = 2 HCl, when 4.0 g of hydrogen reacts completely?
October 20, 2011 by HElp

chemistry
if 50.0 mLs of HCl of unknown concentration is titrated to neutrality with 90.0 mL of .650 M NaOH. calculate the molarity of the HCl
November 14, 2011 by susan

chemistry
if 50.0 mLs of HCl of unknown concentration is titrated to neutrality with 90.0 mL of .650 M NaOH. calculate the molarity of the HCl
November 14, 2011 by susan

chemistry
indicate the concentration of each ion presentin the solution formed by mixing 20mL of .1M HCL and 10mL of .22 M HCL
December 6, 2011 by fdg

chem
How many liters of 1.00 M HCl must be added to 50.0 ml of 0.500 M HCl to give a solution whose concentration is 0.750 M?
January 2, 2012 by Anonymous

chemistry
By titration it is found that 66.1 mL of 0.125 M NaOH(aq) is needed to neutralize 25.0 mL of HCl(aq). Calculate the concentration of the HCl solution.
April 23, 2012 by trae

science
How many milliliters of 4.6 M HCl must be transfered from a reagent bottle to provide 16 g HCl for a reaction? Answer in units of mL
July 24, 2012 by hanan

chemistry
How many milliliters of 5.5 M HCl must be transfered from a reagent bottle to provide 23 g HCl for a reaction? Answer in units of mL
September 13, 2012 by cheri

chemistry
How many milliliters of 5.5 M HCl must be transfered from a reagent bottle to provide 23 g HCl for a reaction? Answer in units of mL
September 16, 2012 by cheri

Chemistry
By titration it is found that 69.9 mL of 0.151 M NaOH(aq) is needed to neutralize 25.0 mL of HCl(aq). Calculate the concentration of the HCl solution.
November 19, 2012 by Janessa

Chemistry
Question 9 Marks: 2 In the reaction: Zn + 2 HCl ZnCl2 + H2 An excess of Zn is reacted with 300.0 g of HCl. How many grams of H2 will be produced?
March 18, 2013 by Lindt

science
a bottel contains 500 ml of 2.4 M HCL. How much water should be added to dilute it to 1.6 M HCL. Solution
June 16, 2013 by aarti

CHEMISTRY
Calculate the volume in liters required to prepare a 5.00M solution of HCL using 15.4gof HCL.
November 15, 2013 by BIBI

chemistry
By titration it is found that 20.5 mL of 0.168 M NaOH(aq) is needed to neutralize 25.0 mL of HCl(aq). Calculate the concentration of the HCl solution
April 27, 2014 by Morgan

chemistry
By titration it is found that 20.5 mL of 0.168 M NaOH(aq) is needed to neutralize 25.0 mL of HCl(aq). Calculate the concentration of the HCl solution
April 27, 2014 by Morgan

Chemistry
If you have 0.150 M HCl solution available, calculate the volume of HCl(aq) necessary for this reaction. _______ml
June 24, 2014 by amber

Chemistry
What is molarity of an HCl sloution if 45.0mL of 0.250 mol/L KOH are needed to neutalize 12.3mL of HCl?
December 1, 2014 by Kathy

chemistry
Mg+2Hcl---mgcl2+h2 volume of h2=40ml Hcl is 6M what mass os h is obtained by addin excess hcl to 6m of magnesium
March 10, 2016 by suni bohr

Chemisty
By titration it is found that 12.1 mL of 0.130 M NaOH(aq) is needed to neutralize 25.0 mL of HCl(aq). Calculate the concentration of the HCl solution.
April 27, 2016 by Tara

chemistry........help!! =)
MaVa = MbVb can be used for the reaction between HCl and NaOH. Can it be used for the reaction between NaOH and H2C2O4 (oxalic acid, which can be found in rhubarb leaves, contains 2 acidic protons)? Explain your answer showing the balanced equation
November 17, 2010 by Stacy

Chemistry(steps check)
I figured out the NO3- which is 0.13, I'm stuck on the Cl- I have 0.24*2-0.0416= 0.4384 but I'm being told that's wrong What mass of silver chloride can be prepared by the reaction of 160.0 mL of 0.26 M silver nitrate with 150.0 mL of 0.24 M calcium chloride? Cl ‾ NO3&#...
June 21, 2013 by Ashley

Chemistry
In the process of separating pb2+ ions from cu+2 ions as sparingly soluble iodates, what is Pb2+ concentration when Cu+2 begins to precipitate as sodium iodate is added to a solution that is initially 0.0010M Pb(NO3)2 (aq) and 0.0010M Cu(NO3)2 (aq)? I know the answer is 1.8*10...
January 29, 2015 by Anonymous

chemistry
Enthalpy and Entropy in Reactions and Solutions Introduction In the course of most physical processes and chemical reactions there is a change in energy. In chemistry what is normally measured is H (enthalpy change), the change in heat at constant pressure and ignoring any ...
November 30, 2010 by allison

Double facts - 2nd Grade
Choose all the double facts you can use to find the sum of 2+3? 1. 2+2 2. 5+5 3. 3+3 4. 1+1
October 21, 2014 by ASG

mastering chemistry
A solution of volume 80.0 mL contains 16.0 mmol HCHO2 and 9.00 mmol NaCHO2. If 1.00 ml of 12 M HCl is added to this, what will be the resulting pH? (the only problem im having for this question is how to approach it, i know that by adding HCl the concentration of the CB would ...
February 28, 2009 by chma11 student

Chemistry - urgent
The following is part of a procedure for a limit test for sulphates in an NaOH sample:- Dissolve 3.0g of NaOH in 6ml of deionized water, adjust to pH 7 with HCl (approx.7.5ml) and dilute to 15ml with deionized water. Please explain how to perform this procedure. Conc HCl or 1M...
September 21, 2010 by candy

Organic Chemistry Lab
How does the allylic halide behave under SN2 and SN1 conditions? Briefly explain why the allylic halide should be able to undergo both SN2 and SN1 mechanisms. If this is any relevant to the question, we did an experiment on the SN1/SN2 reactivity of alkyl halides, using NaI in...
November 7, 2010 by Crystal

Chemistry!
10.2 g of Pb(NO3)2 are dissolved in 100 mL of water, and added to 250.0 mL of a 0.250 M solution of KI. Determine the mass in grams of Pbl2 produced, and find the number of moles of the excess reagent. PLZ explain chemistry - DrBob222, Monday, December 13, 2010 at 4:30pm...
December 14, 2010 by jenni

chemistry
What is the concentration of NaOH? using this solution (0.04756 M (i think its stand for Molarity) H2SO4) what is the concentration of NaOH in 10.00 ml of a solution, titrate to an end point using 24.22 ml of acid? formula that was given is (H2SO4 + 2NaOH --> Na2SO4 (aq) + ...
March 16, 2012 by star

English, grammar
I need some help with this question for one of my units in world englishes please help!? Q. Argue for or against the status of 'double negation' as a 'mistake' on spoken English. I am arguing for so I agree with this status. I believe double negation in spoken English can ...
August 28, 2013 by Anonymous

Chemistry - Density
Automobile batteries contain sulfuric acid. Calculate the number of grams of sulfuric acid in 0.500L of battery acid if the solution has a density of 1.28g/mL and is 38% H2SO4 (small numbers) by mass? Can you please answer this for me? density = 1.28 g/mL mass of 1 L is 1.28 g...
October 5, 2006 by Tracey

Chemistry
(NH4)2S+CuSO4=
April 22, 2013 by judy

chemistry
A 27.00mL sample of an H2SO4 solution of unknown concentration is titrated with a 0.1422M KOH solution. A volume of 40.22mL of KOH was required to reach the equivalence point. What is the concentration of the unknown H2SO4 solution? Any help would be greatly appreciated. (:
December 14, 2014 by Luis

Organic Chemistry
Hi, I did an extraction experiment. I've got my basic layer, and getting my acidic salt in return. To do this, I am instructed to first "add a small amount of NaCl to help with the product precipitation". Then, again I am instructed to add HCl to "acidify" the solution. With ...
November 3, 2014 by Juan

Chemistry
Tap water that contains Cl− at a concentration of 50 ppm is used to prepare a 0.100 mol/L AgNO3 solution. Does a precipitate form? How much? I don't know how to find out how much precipitate will form but a precipitate will form based on my calculations 50 ppm 0.0014 mol...
May 31, 2015 by Rez

Science
The compound which will form the strongest dipole between CCl4;CO2;BF3;HCL;PF3
April 28, 2016 by Metse

ap chemistry
please explain titration problems. I'm a total noob at this and am trying to answer some prelab questions. Examples: 1. How many mL of a 0.800 M NaOH solution is needed to just neutralize 40 mL of a 0.600 M HCl solution? 2. You wish to determine the molarity of a solution of ...
October 2, 2008 by chris

CHEMISTRY 1
What is the correct net ionic equation, including all coefficients, charges, and phases, for the following set of reactants? Assume that the contribution of protons from H2SO4 is near 100 %. Ba(OH)2(aq)+H2SO4(aq)→ Express your answer as a chemical equation. This is what ...
October 6, 2014 by Run

Chemistry
Can someone show and explain to me step by step how to do the problems? I feel like I am doing it incorrectly. a) The solubility of PbI2 is 3.67 mg per mL. What is the Ksp? b) Three drops of 0.20 M potassium iodide are added to 100.0 mL of 0.010 M lead nitrate. Will a ...
March 25, 2014 by Miki

chemistry
what simple test would you use to identify the possible presence of HCl(aq)? What result do you expect if the solution is HCl(aq)?
October 16, 2008 by Lili

chemistry
Assuming that the volumes are additive , how much water should be added to75.0 mL of 6.00 M HCl to prepare 0.500 M HCl?
December 5, 2009 by Alizza

Chemistry
A 20.0-mL sample of 0.20M sodium acetate is titrated with 0.11M HCl(aq). What is the pH after the addition of 50.0-mL HCl(aq)? (Kb of CH3CO2 = 5.6x10^-10)
March 26, 2010 by Sean

chemistry
I need 500 ml of 0.10 m HCL solution. I have a 3.785 liter container of HCL at 31.45% concentration. How do I acheive my objective?
October 16, 2010 by Daniel

chemistry
What is the concentration of HCl in a 250.0 mL sample of hydrochloric acid if 15.5 mL of 0.0100 M NaOH is needed to react with all the HCl?
February 22, 2011 by Maddy

Chemistry
For the following reaction: 6ClO2 (g) + 3H2O (l) = 5HClO3 (l) + HCl (g) If a chemist wants to make 55.0 g of HCl, how much ClO2 is needed?
November 14, 2011 by Carrie

Chemistry
2 Fe (s) + 6 HCl (aq) -> 2 FeCL3 (s) + 3 H2 (g) How many liters of H2 would be formed if 200 g of Fe completely reacted with HCl at 40 degrees Celsius and 1.5 atm?
May 24, 2012 by Lily

balaji pharmacy clg ,science
why it is taken 85ml of hcl for 1 lt of solvent according to I.P. while it is 43.02ml of hcl when it is calculated?
January 13, 2013 by shaziya

balaji pharmacy clg ,science
why it is taken 85ml of hcl for 1 lt of solvent according to I.P. while it is 43.02ml of hcl when it is calculated?
January 13, 2013 by shaziya

Lone Peak High
How much of a stock (18.5 M) HCl solution would be required to make 100mL of 0.025 M HCl?
June 7, 2014 by Annie

Chemistry
How much water must be added to make 500 ml of 12.0 M HCl to 1.0 M HCl (500mL• 12M) / 1.0M =6000m Is this correct?
May 8, 2015 by Carl

Chemistry
How much water must be added to make 500 ml of 12.0 M HCl to 1.0 M HCl (500mL• 12M) / 1.0M =6000m Is this correct?
May 10, 2015 by Carl

chemistry
12M HCl + H20→ 5M HCl How much water? Total Volume= Pls I need this tomorrow
September 1, 2016 by jack

chemistry please help!!
4{C3H5(NO3)2}(l)--->6N2(g)+O2(g)+12CO2(g)+10H2O(g) If a dynamite of 100mL needs 3.5atm to explode, what minimum mass of C3H5(NO3)2 do I need to put in at 25 degree celcius? I tried to do this by finding the number of moles by the formula PV=nRT and then convert that into ...
October 22, 2008 by ashley

chemistry
How do I prepare 10% w/v HCl from 37%(w/w) HCl (density 1.19g/ml)? Thanks.
June 22, 2009 by Carol

adult education
How many moles of HCL are in 50.0 mL of 0.600 M HCl?
July 20, 2010 by santhosh

AP Chemistry
what is the number of moles of HCl in 50mL of 1.0M HCl
December 1, 2010 by Sam

science
50 mL 3.0 M HCl(aq) that means hw much HCl . Can anybody ilaborate it
March 8, 2011 by Tumpa

Science
How do you calculate the preparation of 0.1M HCl using 33% HCl?
March 20, 2014 by Raksha

Chemistry ,Reactions at Electrodes during Electrol
Reactions at Electrodes during Electrolysis Which half-reaction will take place at the cathode during the electrolysis of molten MgCl2? 2Cl- > Cl2 + 2e- Cl2 + 2e- > 2Cl- Mg2+ + 2e- > Mg Mg > Mg2+ + 2e- Which half-reaction will take place at the cathode during the ...
April 8, 2012 by Mahtab

CHEMISTRY FORMULA
How would you write the chemical formula for Mercury(I) nitrate. i have Hg(NO3)2 since the charge of nitrate is -2 and Mercury's is 1. However, upon checking online i found that the correct formula is Hg2(No3)2. I don't understand where the subscript 2 of Hg originated from' ...
October 17, 2010 by Moi

Math
A bag contains 4 green marbles, 6 red marbles, and 2 white marbles. Three marbles are drawn at random with replacement. With replacement means that after a marble is drawn, it is replaced before the next one is drawn. What is the probability of not green, not red, not white?
May 18, 2012 by Junior

English/Grammar help
The sentences below have transitive verbs so each verb has a direct object. Read each sentences and underline its direct object. (Underline the subject once, and double underline the action verb and circle the do.) please correct me if I'm wrong! 5. He removed the picture from...
September 6, 2014 by Anonymous

Chemistry
Explain the difference in bond lengths of N2, O2, and F2. Ans: I assume it's because of bond order (single, double, and triple bonds). Explain the difference in bond lengths of HF, HCl, and HBr. Ans: I'm not sure about this one???
April 14, 2009 by John Jeremy

Chemistry
out of these conditions, which would result in fastest reaction? a. 2.0M HCL, powedered CaCO3 chip, 50 degrees celsius b. 6.0M HCL, CaCO3 chip, 25 degrees celsius c. 6.0M HCL, powdered CaCO3, 50 degrees celsius. d. 2.0M HCL, CaCO3 chip, 50 degrees celsius. Im guessing C ...
September 25, 2012 by Shreya

Chemistry
A 23.596 g sample of aqueous waste leaving a fertilizer manufacturer contains ammonia. The sample is diluted with 79.504 g of water. A 13.803 g aliquot of this solution is then titrated with 0.1098 M HCl. It required 29.02 ml of the HCl solution to reac the methyl red endpoint...
November 14, 2011 by Mike

chemistry
A 23.596 g sample of aqueous waste leaving a fertilizer manufacturer contains ammonia. The sample is diluted with 79.504 g of water. A 13.803 g aliquot of this solution is then titrated with 0.1098 M HCl. It required 29.02 ml of the HCl solution to reac the methyl red endpoint...
November 14, 2011 by Mike

chemistry
in a vessel, 0.6 mol Ba(NO3)2 and .3 mol H3PO4 are combined w deionized water to a final vol of 2 L. 3Ba(NO3)2 + 2H3PO4 --> Ba3(PO4)2 + 6HNO3 1. Calclate mass of Ba(PO4)2 formed 2. calcualate pH of HN03 3. What the concentation in mol/L of the nitrate ion after the rxn ...
March 10, 2010 by im stressed!

Chemistry
2) To the solution in problem 1 (d) at 100 degrees celsius, 10g of water are added, and the solution is cooled to 0 degrees celsius... (problem 1d: the number of grams of water required to dissolve a mixture containing 15 g KNO3 and 3.5 g CuSO4 * 5 H20, assuming that the ...
September 18, 2012 by Sam

Heat Capacity
When a 3.25 g sample of solid sodium hydroxide was dissolved in a calorimeter in 100 g of water, the temperature rose from 23.9 C to 32.0 C. Calculate delta H (in kJ/mol) of for the solution process: NaOH (s) -> Na+(aq) + OH-(aq) Use a calorimeter heat capacity of Ccal = 15...
December 18, 2012 by Jamie

chemistry
Suppose that 2.00mL of 0.02 mol/L aqueous sodium sulphide, Na2S is used to test a 60.0mL sample of water containing 0.0004 mol/L mecury (II) nitrate Hg(NO3)2, ions. a. Write the balanced equation Hg(NO3)2 + Na2S = HgS + 2NaNO3 b. Determine the limiting reactant Na2S = 2.00mL/...
April 8, 2015 by sharon

chem
I am having lots of trouble with these questions: Classify each of the following reactions in as many ways as possible. (Select all that apply.) a)2 Rb(s) + Br2(g) 2 RbBr(s) you can select: -acid-base -double-displacement -gas evolution -oxidation-reduction -precipitation -...
November 29, 2010 by hannah

BIO 12
BIO 12 DNA DOUBLE HELIX. Hi, I'm having troubles understanding the following question(s) and was wondering if anyone could give me a hand? Original DNA Double Helix: TACGGGATACCGCCGTTCACACGT ( Starting From Left; Position #1 would be between the first A and T, Position #2 ...
September 24, 2015 by Stephanie

statistics
Please help asap! A tire company is considering a tire replacement company. They have agreed to replace any tire that fails with a life in the bottom 10% of the population. For a given population of tires, the life is a normal distribution with a mean of 27 months and a ...
January 18, 2011 by Going crazy

Chemistry
Need help with this lab: (sorry so long) Hypothesis: The amount of product will be regulated by the limiting reactant. Procedure: First, I took two test tubes from the Glassware shelf. I added 6 mL of the copper sulfate solution to one, and 6 mL of the sodium sulfide solution ...
November 14, 2009 by anonymous

Chemistry
A sample of CuSO4*5H2O was heated to 110 degrees C, where it lost water and gave another hydrate of copper (II) ion that contains 32.50% Cu. A 98.77-mg sample of this new hydrate gave 116.66 mg or barium sulfate precipitate when treated with barium nitrate solution. What is ...
June 11, 2009 by Help Please!!!!!!

3rd grade math
Double my tens digit to get my ones digit. Double me and I am less than 50. Who am I?
May 12, 2010 by Pam & Hannah

Science
How resistivty of conductor vary if area is halved,length is double,area is double
September 11, 2016 by Anonymous

Chemistry
We conducted a lab with antacids in class the other day and i'm having trouble doing the calculations. Well we basically took antacid tablets dissolved them in HCl, heated it and then added phenolthalien and then titrated until we saw a pink color. At 41mL we saw the pink and ...
March 15, 2010 by Anonymous

chemistry
A chemist needs a HCl solution with a molarity of less than 0.400 M for an experiment. To find out if a sample of HCl solution can be used in the lab, the chemist performs a titration to neutralize 59.2 mL of the HCl with 45 mL of 0.400 M NaOH. Based on the results, will the ...
January 31, 2014 by Matthew

Chemistry - Heat Capacity
When a 3.25 g sample of solid sodium hydroxide was dissolved in a calorimeter in 100 g of water, the temperature rose from 23.9 C to 32.0 C. Calculate delta H (in kJ/mol) of for the solution process: NaOH (s) -> Na+(aq) + OH-(aq) Use a calorimeter heat capacity of Ccal = 15...
December 17, 2012 by Amy

Chemistry Check
The Synthesis of hydrogen chloride is written H2+Cl2==>2HCl. 3L of hydrogen are used and all gasses are at STP. The volume of HCL produced in the reaction would be _______ L. would the answer be 5.96? Three liters of H2 yields six liters of HCl, from the balanced equation. ...
January 19, 2007 by Briana

Chemistry
please check my answers. THANK YOU. 1) The percent by mass of carbon in acetone, C3H6O is. Answer: 62.1% 2) What is the percent by mass of zinc, Zn, in ZnCO3? Answer: 52.3% 3)What is the percentage of water in the compound BaCl2 * 2H2O? Answer: 7.96% 4)How many atoms are in ...
August 1, 2007 by anonymous

Physics Classical Mechanics
Consider a double star system under the influence of the gravitational force between the stars. Star 1 has mass m1 = 2.32 × 10^31 kg and Star 2 has mass m2 = 1.76 × 10^31 kg. Assume that each star undergoes uniform circular motion about the center of mass of the system (cm...
October 21, 2013 by Anonymous

  1. Pages:
  2. <<Prev
  3. 14
  4. 15
  5. 16
  6. 17
  7. 18
  8. 19
  9. 20
  10. 21
  11. 22
  12. 23
  13. 24
  14. 25
  15. 26
  16. 27
  17. 28
  18. Next>>