Thursday
October 30, 2014

Search: genetics/biology

Number of results: 5,709

AP BIOLOGY
I have a quiz on genetics on friday in AP Biology and I would like some sites with good ap biology questions on them. I don't know any of them which I could go to.
December 3, 2008 by Roger

Biology 101
How are meiosis and genetics related?
October 25, 2010 by Anita fields

biology
how does the urinary system support reproduction and passing on genetics?
June 27, 2009 by Liz

biology - genetics
is the cis-regulatory sequence found in the exome?
March 26, 2014 by santoki

Biology - genetics
How does crossing over change the combination of alleles in gametes? Thanks :)
August 23, 2012 by Cally

Biology -Genetics
True or False X and Y chromosomes are found only in eggs and sperm. T or F ?
March 5, 2014 by Amy

Biology quick please
I need a practice biology test to practice for my final exam which is tomorrow. I'm a tenth grader and the things we learned were mitosis, meiosis, production of gametes, human reproduction, cell devision, mendelian genetics, probablitity of inheriting traits, dna, and what ...
December 15, 2009 by Rachel

Biology 101
Summarize the inheritance of sex-linked traits through meiosis and how it relates to genetics.
October 25, 2010 by Anita fields

Biology 101
Summarize the inheritance of sex-linked traits through meiosis and how it relates to genetics.
October 26, 2010 by Anita fields

biology
In reference to plant and animal adaptations, how are the principles of heredity and genetics applicable to how organisms change over time?
August 12, 2011 by Anonymous

biology
studying genetics in mammals where can i find out about felines and canines that are proven mainly allergen free, thought not genetically modified?
September 22, 2009 by elizabeth

Biology!!
The lifespan of plants varies depending on genetics and survival strategies. Discuss the adaptive value of annual, biennial, and perennial life spans.
January 26, 2011 by NEEDS HELP!!

biology
How does the circulatory system and the lymphatic system support reproduction and passing along genetics?
June 27, 2009 by Liz

Criminal Justice
Discuss the merits of the idea that genetics are a source for criminal behavior. Make sure to provide examples that can be found through research studies and have evidence linking genetics and crime, including twin studies, adoption studies, and testosterone studies. What are ...
September 8, 2013 by Danita

Biology
A 50 year old male who is not overweight and has normal blood cholesterol levels suffers a heart attack. Propose a possible explanation i think the answer would be genetics...
October 1, 2014 by Sam

biology
how does the existence of cells, organelles, cellular reproduction, natural selection, DNA replication, transcription, translation, heredity, genetics, mutations, and taxonomy provide evidence that supports the theory of evolution?
June 15, 2008 by Aneesah

Genetics/Biology
Recombination frequencies a. arise from completely random genetic exchange. b. are the same for all genes. c. decrease with distance. d. are the same for cis and trans heterozygotes.
March 18, 2010 by Sonya

biology
Are an organism's characteristics determined only by its genes? Explain. Yes, an organism's characteristics are determined only by It's genes becuase the parents give their offspring genes which determines their characteristics. Is my answer correct? Do I need to expand on ...
February 25, 2007 by franny

Please Help Me :( Science: Biology, Genetics!
Please help me with science genetics questions? Thanks to all who answer!! :) 1. Chromosome pairs contain different versions of genes, which are called ________. 2. The process in which body cells are duplicated in order to grow and repair body tissues is called _____________...
March 10, 2014 by Hannah

genetics/biology
I am having trouble wording this question. Describe the differences in the outcomes for a dihybrid cross ifgenes are: a. completely linked b. completely unlinked c. incompletely linked.
April 15, 2012 by Lucylu

Biology: Genetics
18.Which of these is true of meiosis? A. n → 2n B. n → n C. 2n → n D. 2n → 2n Is C. the right aswer?
August 13, 2014 by Anonymous

Biology
So I am completely confused. I am in the process of taking a quiz and the question says "a factor that seems to disappear" my options are punnet square, heredity, dominant factor, recessive factor, alleles, or genetics??? Help please? Thanks
January 10, 2013 by lazyburrito

Biology - Genetics
I have not been able to find any more in depth websites/answers for this question. DNA is considered to be a relatively stable molecule. What is it that gives the molecule its stability when the hydrogen bonds between the nitrogen bases are so easily broken?
October 31, 2007 by Me-ki

biology - genetics
how do you compare the reversibility of point mutations and microsatellites? I thought point mutations could reverse but microsatellites can't but idk the reason.
March 25, 2014 by santoki

biology genetics
In Leghorn chickens, + stands for colored feathers and C represents white feathers. At an independently inherited gene, the allele + inhibits color expression, whereas I has no effect on color expression
October 16, 2011 by john

Biology: Genetics
18.Which of these is trueof meiosis? A. n → 2n B. n → n C. 2n → n D. 2n → 2n Is it C.?
August 13, 2014 by Anonymous

Genetics/Biology
What kind of inheritance is it when the offspring have spots of different colors from its parents? Like a brown dog with a white dog makes a white/brown spotted dog.
December 7, 2008 by Claire

biology
All of the following important concepts of population genetics are due to random events or chance except mutation natural selection the bottleneck effect the founder effect sexual recombination I am pretty sure that the answer would be "natural selection", but I wanted a ...
January 31, 2009 by Gail

biology, genetics
Suppose that r, red, and sc, scarlet, are two recessive eye-color mutations that lie 20 map units apart on the Drosophila X chromosome, and that each causes a red eye color in place of the wild type purple color. A. If a female from pure-breeding rr stock is mated with a red-...
February 21, 2014 by Rain

Genetics
A homozygous pea plant with round peas and yellow cotyledons was crossed to a wrinkled, green plant. The F1 was selfed and produced: 193 round, yellow 69 round, green 64 wrinkled, yellow 26 wrinkled, green a) propose hypothesis that allows you to calculate expected values ...
September 2, 2011 by Tommy

Biology (genetics)
The RAS protein acquires a mutation that prevents release of GTP. Which of the following characteristics are these cells likely to acquire? a)Self-sufficiency in growth signals b) insensitivity to anti growth signals c) angiogenesis d) metastasis e) blocking apoptosis I ...
October 15, 2011 by Bach

biology / CELEISTINE
describe the genetics of the huntigton disease a. what chromosomes are affected? b. is it a result on translocation/ c. is it a sex-linked? d. does it skip a generation 3. waht are the cause of huntington disaese? how does it occur ? is it preventable ? how ? 4. waht are the ...
April 11, 2008 by natacha? HUNTINGTON DISEASE

Biology
Is 9th grade biology hard? Is it interesting...?? I love life science but I just wondering if 9th grade biology hard??? I'm taking biology next year.
April 29, 2013 by Sarah

genetics
need help with these genetics problems. please help with what you can. thanks: Given that loci A and B in Drosophila are sex-linked and 20 map units apart, what phenotypic frequencies would you expect in male and female offspring resulting from the following crosses? (Assume A...
September 24, 2007 by stew

Biology
The allostery of an enzyme governor is likely to take two forms.They are? A.active and regulatory B. rigid and flexible c. active and passive e. regulatory and relaxed http://en.allexperts.com/q/Biology-664/biology-73.htm http://en.allexperts.com/q/Biology-664/biology-73.htm
August 10, 2007 by Sajia

Genetics
Whats a homolog?
November 3, 2008 by Lena

Genetics/biology
Can anyone comment as to wether this solution is correct for this question plaese !! Draw a mating diagram where L is the dominant gene for the digestion of lactose and shows the crosses between two heterozygotes and wiht the the phenotypic and genotypic ratio of the offspring...
March 22, 2007 by Freddo

Genetics/biology Advice
Can anyone comment as to wether this solution is correct for this question please !! Draw a mating diagram where L is the dominant gene for the digestion of lactose and shows the crosses between two heterozygotes and wiht the the phenotypic and genotypic ratio of the offspring...
March 22, 2007 by Freddo

Science Fair
I'm doing my science fair project on like how healthy and junk food affect the human body. I check on the site (Rockland Sit Fair) and reading the Project Categories. Does these project categories below relates to my project??? Medicine and Health: Study of diseases and health...
December 29, 2011 by Lauren

Science
How are the structures in genetics related?
October 5, 2010 by Jack

science
why are karyotypes important tools for genetics?
May 12, 2009 by Anonymous

Psych
CAN SOMEONE REVIEW MY ANSWERS AND TELL ME IF THIS IS CORRECT? Why is it flawed to ask how much of a particular behavior is due to genetics and how much is due to experience? It is inconsistent to think that behaviors are solely due to our genetic make-up. When it comes to our ...
January 30, 2009 by SinnerSaved

Science, Genetics
Please help me with science genetics questions? Thanks to all who answer. :) 1. Chromosome pairs contain different versions of genes, which are called ________. 2. The process in which body cells are duplicated in order to grow and repair body tissues is called _____________. ...
March 10, 2014 by Hannah

AP Biology- Molecular Genetics
The correct sequence between genes and their phenotypic expression is a) RNA-DNA-protein-trait b) DNA-RNA-protein-trait c) Protein-DNA-RNA-trait d) trait-DNA-RNA-protein I think it is either b or d but do not know if the trait is at the beginnig or end... Once translated, the ...
March 14, 2011 by Jill

science
What is a result of scientific research in the field of genetics
March 19, 2010 by Melanie

Biology "Genetics"
Red-green Color Blindness and Hemophilia A are both sex-linked traits in humans. Both genes are on the X-chromosome and are tightly linked. Consider the pedigree below. Individual 1 is homozygous normal. Individual 2 is both red-green color blind and a hemophiliac. Individual ...
April 2, 2013 by grad2013

science
I am looking for my study guide - what ends translation ( genetics)
March 18, 2009 by sam

6th grade genetics
transferring a gene from one organism to another
May 26, 2009 by kay

Genetics
Can chromosome instability cause an individual to be highly susceptible to cancer?
October 3, 2009 by Sarah

Genetics
Can you help me determine the phenotype and proportions expected from these crosses in chickens? a) RR Pp x rr Pp b) rr PP x Rr Pp c) Rr Pp x Rr pp
September 9, 2011 by Tommy

early childhood
evolutionary psychology and behavior genetics: watson
February 23, 2012 by jen

Biology - Genetics
Please help me!!!! I need help with this practice test question. In Guinea pigs, the brown coat (B) is a dominant over the cream-coloured coat (b), and straight hair (H) is dominant over curly hair (h). Using a Punnett square, complete the cross between a heterozygous brown, ...
January 10, 2012 by Lisa

Art
Could you please check scientific English in this short dissertation? Thank you, Ms. Sue. 1) Conrad Waddington introduced the term epigenetics in the early 1940s. He defined epigenetics as ‘‘the branch of biology which studies the causal interactions between genes and their ...
June 7, 2012 by Mike

Genetics
what is the chance of a woman having five female children in a row?
January 9, 2008 by Matthew

human Genetics
In a mouse cell at the start of mitosis, how many chromatids are present?
September 15, 2011 by kay

Genetics
In general, what two methods are used to grow bacteria in the laboratory?
February 8, 2012 by Anon

SCIENCE (GENETICS)
if there are two forms of each of the seven traits, how many possible combinations are there?
May 23, 2012 by JEN

genetics
What kinds of amino acids on histone tails are able to be phosphorylated and why?
October 14, 2012 by ren

biology tutor on jiskha
i post my biology questions here today and few days ago no teacher reply. there not any biology tutor on here?
February 22, 2012 by Shreya

genetics
What would happen during DNA replication if there were no thymine nucleotides available?
October 28, 2009 by sam

7th grade science
Why was Gregor Mendel given the title "The Father Of Genetics" ?
December 13, 2009 by mary

Genetics
The following DNA segment has one ORF. Do you know what it codes for? 5'-TAGGATGTTCGACATGTAAGCTT ATCCTACAAGCTGTACATTCGAA
November 10, 2011 by Tony

quick science question
What are some ways in which genetics collect samples to test for disorders?
August 28, 2009 by Lauren

biology: genetics
You are attempting to determine whether a plant-derived processed food sample (for example, a corn chip) contains material from a genetically-modified organism (GMO). First, you crush the sample and attempt to extract DNA from it. Next, you perform PCR using two different sets...
July 20, 2011 by billy

7th grade science
name two scientest who studied inherited genetics and what they used for research and why
November 17, 2009 by alice

Genetics
What is an approximate value of the length of a 30 nm fiber that contains 120,000 nucleotide pairs of DNA?
October 31, 2011 by Kyle

bio : fundamentals of genetics
A 3:1 ratio of tall to short plants in the F2 generation lends support to the principle of ________________.
June 1, 2008 by Henry

Biology-genetics
tribbles were fictional animals featured in a certain , now ancient ,science fiction television series. Lets say that tribbles have an X-Y sex determination mechanosm like that of humans. the trait bald (Xb) is X-linked and recessive to furry (Xb+), and the trait long legged (...
June 16, 2008 by Jenish

biology
Hi there! I have this question for my bio/genetics homework, and I can't seem to figure it out. It reads, "A true-breeding red snapdragon is crossed to a true-breeding white snapdragon. The F1 progeny are all red. When the F1 is selfed, the following F2 progeny are observed: ...
October 3, 2011 by Jennifer

Biology: Genetics
In guinea pig, short hair (L) is dominant to long hair (l) and the heterozygous condition for yellow coat (Y) and white coat (y) gives cream coat. A short haired guinea pig is bred to long haired white guinea pig and one of the offspring is a long haired baby guinea pig. a. ...
February 4, 2014 by Ethan

Biology:Genetics
In guinea pig, short hair (L) is dominant to long hair (l) and the heterozygous condition for yellow coat (Y) and white coat (y) gives cream coat. A short haired guinea pig is bred to long haired white guinea pig and one of the offspring is a long haired baby guinea pig. a. ...
February 4, 2014 by Jez

Biology
Is there any biology websites for teens??? (NOT games! notes and quizzes to practice). The Science of Biology The Chemistry of Life Cell Structure and Function Photosynthesis & Respiration Something REALLY easy to understand(btw I'm going to the 9TH GRADE). please help (having...
July 17, 2013 by Laruen

GBE (Genetics)
What are the advatages of Eukaryotic genes splitting up? I'm not so sure how to approach the question, is it something to do with exons & introns or the nucleotide sequences?
October 7, 2008 by Claire

psychology
If you had to argue that either genetics (nature) or environment (nurture) has the greater impact on human development, which would you pick and why?
March 1, 2011 by Rica

law ans ethics in allied health
the science of improving hededitary is known as a.genetics b.amniocentesis c.dna research d.eugenics my answer is a
November 10, 2013 by susue

psychology
humanistic therapy acknowledge unconscious forces and --- as a source of personal difficulties environment negative thoughts genetics psychosis please help
April 16, 2012 by kevin

biology
How could i understand the biology? can u please give me some reference to look for that.. tnx...
July 16, 2008 by maico

Biology
when might you use the "poor-quality website" in an academic Assignment in Biology?
March 28, 2009 by biology

biology
Name three ways that the science of biology has/does, or might impact you as an individual.
October 3, 2010 by malachi

biology
i did biology post yesterday i not find it someone please tell me where it go?
February 4, 2012 by Mohammad

biology
ap biology lab -what barriers might hinder the acquisition of plasmids
May 17, 2013 by hannah

biology
need help with a paper from news article on human biology using scientific method?
April 21, 2012 by tracy

biology
Why is cell culture one of the most valuable technical achievements in the entire study of biology?
March 11, 2010 by alex

Biology
Why is feedback inhibition a useful thing for enzyme reactions in a cell? Are there biology tutors in this forum??
December 13, 2013 by Anonymous

biology
what is burgess shale? what is the significance of this discovery to evolutionary biology
September 8, 2012 by ami

Genetics
Question: Calculate the frequency of the AA, Aa, and aa genotypes after one generation if the initial population consists of 0.2 AA, 0.6 Aa, and 0.2 aa. What I have done is: P = (0.2)+(0.5)(0.6)= 0.50 q = 1-p = 1 - 0.50 = 0.50 Can someone check my answer plz.
December 6, 2006 by Josh

genetics
Given the gene sequence ABCDE, crossing over should occur most frequently between_____. a. A-B b.) B-C c.) A-E d.) A-D e.) A-C PLEASE explain how you got the answer thanks!
October 26, 2013 by nini

Biology
This is my question from my Biology paper. List which organs and tissues come from the mesoderm primary cell layer. Thanks
October 16, 2008 by Rocky

BIOLOGY
can someone explain how i would write an interpolation and extrapolation in a conclusion statement for a biology project? i don't know how to word it.
January 14, 2009 by SMITHly

genetics
Suppose that for an organism, 2N = 8. How many chromosomes do the organism's gametes contain? Would it be 8?
February 25, 2007 by franny

genetics
Once the _______ checkpoint is passed in the cell cycles, the cell is committed to division
May 14, 2013 by Anonymous

BIOLOGY: GENETICS
Q) In D. virilise, the mutations dusky body (dy), cut wings (ct) and white eyes (w) are all recessive alleles located on at different places on the x chromosome. Females heterozygous for all three mutations were crossed to dy ct w males, and the following phenotypes were ...
October 4, 2009 by Susan

statistics
1. Use the following information about a group of college students: Fifty percent are taking Algebra. Sixty percent are taking Biology. Thirty percent are taking both Biology and Algebra. A student from the group is selected at random, calculate the following: a) The ...
September 18, 2011 by Ahmad

Biology
How can we solve the problems of global warming by using biology technology? In other words, what biology technology helps solve global warming? I can't think of anything. Please help! Thanks You.
January 10, 2010 by Anonymous

biology
what all do i need to know for GCSE biology my teacher is absolutely rubbish i tried websites but i don't find them helpful thankyou
April 15, 2012 by ellen

biology
What exactly is holistic biology and what are some examples of it? Thank you.
September 29, 2007 by Fred

biology
what is the importance of cell theory to the study of biology
March 12, 2008 by grace

biology honors
what was leonardo da vinci's contrabution to biology ?
November 9, 2008 by mayme

Biology
Are solar panels biology technology (biotechnology)? Thanks.
January 10, 2010 by Anonymous

biology
what are the seven major theories of biology sumerized
September 24, 2010 by susan marshall

Pages: 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | Next>>

Search
Members