Friday
April 18, 2014

Search: genetics

Number of results: 478

Psychology
Yes, genetics is an important possible factor in addiction. Here is a site on that. http://learn.genetics.utah.edu/units/addiction/genetics/
Tuesday, June 3, 2008 at 12:42pm by GuruBlue

Genetics
This i s not my area, but you might like to have some of the following Genetics Tutorials: https://www.google.com/search?q=Genetics+Tutorials&ie=utf-8&oe=utf-8&aq=t&rls=org.mozilla:en-US:official&client=firefox-a Sra
Thursday, November 10, 2011 at 3:08am by SraJMcGin

Genetics
You might like to have some of the following links on Genetics Tutorials: http://search.yahoo.com/search?fr=mcafee&p=Genetics+tutorials Sra
Monday, October 31, 2011 at 1:23am by SraJMcGin

Criminal Justice
Discuss the merits of the idea that genetics are a source for criminal behavior. Make sure to provide examples that can be found through research studies and have evidence linking genetics and crime, including twin studies, adoption studies, and testosterone studies. What are ...
Sunday, September 8, 2013 at 8:37pm by Danita

science
I would recommend finding a journal database related to genetics, and looking at a current issue. You can see a lot of findings there. If you don't have access to these from your school library, try googling Journal Genetics.
Friday, March 19, 2010 at 12:17pm by anony mouse

Accounting-- any comments please
Mendel is the father of modern genetics, but there are some genetic characteristics that cannot be explained by simple Mendelian genetics. Such is the case with the human blood types in which there are 3 alleles for the same gene, A B, and o. A parent can pass allele A, B, or ...
Monday, August 7, 2006 at 10:46am by Anonymous

biology
genetics offers diversity (many different combinations of DNA were involved), and mutations occured also. So, with all this diversity in genetics, some of the adaptations might lend favorable to reproduction, or fitness to survive. Those adaptations then will reproduce at a ...
Friday, August 12, 2011 at 5:38pm by bobpursley

SCIENCE
http://en.wikipedia.org/wiki/Genetics
Friday, May 22, 2009 at 12:31pm by Ms. Sue

Science
http://learn.genetics.utah.edu/content/inheritance/
Thursday, January 16, 2014 at 6:12pm by Ms. Sue

Biology 101
Try some of the following links on Genetics: http://search.yahoo.com/search?fr=mcafee&p=summarize+inheritance+of+sex-linked+traits+through+meiosis+%26+how+it+relates+to+genetics Sra
Tuesday, October 26, 2010 at 4:26pm by SraJMcGin

Biology
Do you know what the terms, "dominant" and "recessive" mean? http://en.wikipedia.org/wiki/Dominance_(genetics)
Saturday, March 24, 2012 at 8:10pm by PsyDAG

Biology Genetics
The sperms would then reflect the genetics received from each paternal grandparent, one set from paternal grandpa and one from paternal grandma, as it was in the conception of the father. However, would you have that same factor in the development of the ovum, or would there ...
Monday, March 30, 2009 at 6:54pm by PsyDAG

SCIENCE
It can be genetics, but also offspring learn from their parents. The more complex the organism, the greater the role of learning. Thus the characteristics of higher level organisms are developed from a complex interaction between genetics and life experiences. One of the main ...
Friday, May 22, 2009 at 12:31pm by PsyDAG

How to do a big punnet square
http://www.changbioscience.com/genetics/punnett.html for the example square, use genotype at the last choice (3 types) x 3types, press go.
Wednesday, May 20, 2009 at 7:28pm by bobpursley

Genetics
Here are some tutorials you might like: http://www.google.com/search?q=Genetics+tutorial&ie=utf-8&oe=utf-8&aq=t&rls=org.mozilla:en-US:official&client=firefox-a Sra
Friday, September 2, 2011 at 4:21pm by SraJMcGin

Science
Yes. See http://library.thinkquest.org/20830/Textbook/Genetics.htm I hope this helps. Thanks for asking.
Wednesday, January 9, 2008 at 4:00pm by PsyDAG

History8
http://learn.genetics.utah.edu/content/gsl/physical_char/
Saturday, January 25, 2014 at 4:50pm by Damon

Biology
Here are some Genetics Tutorials to look through: http://www.google.com/search?q=Genetics+tutorials&ie=utf-8&oe=utf-8&aq=t&rls=org.mozilla:en-US:official&client=firefox-a Sra
Friday, September 16, 2011 at 12:52pm by SraJMcGin

Biology
http://www.emunix.emich.edu/~rwinning/genetics/chrom.htm
Saturday, June 5, 2010 at 6:30pm by Ms. Sue

science(biology)
http://learn.genetics.utah.edu/content/begin/traits/blood/
Friday, March 25, 2011 at 1:54pm by TutorCat

Genetics/Biology
Here are some places to try: http://www.google.com/search?q=on+genetics%2C+recombination+frequencies&ie=utf-8&oe=utf-8&aq=t&rls=org.mozilla:en-US:official&client=firefox-a Sra
Thursday, March 18, 2010 at 5:20pm by SraJMcGin

7th grade science
How about the Tasmanian Devil. http://www.brighthub.com/science/genetics/articles/13897.aspx
Tuesday, January 4, 2011 at 1:05am by Dr Russ

Ag. Bio
Translation in genetics means "the decoding of an mRNA message". Like you would translate a phrase in a foreign language(like Spanish)to English,a process is used to translate the code of an mRNA message into a protein. The word Transcription in genetics is like "writing out" ...
Wednesday, April 14, 2010 at 11:54pm by Anonymous

Science
Try here: http://search.yahoo.com/search?fr=mcafee&p=how+are+the+structures+in+genetics+related Sra
Tuesday, October 5, 2010 at 9:58pm by SraJMcGin

Genetics
A homozygous pea plant with round peas and yellow cotyledons was crossed to a wrinkled, green plant. The F1 was selfed and produced: 193 round, yellow 69 round, green 64 wrinkled, yellow 26 wrinkled, green a) propose hypothesis that allows you to calculate expected values ...
Friday, September 2, 2011 at 4:21pm by Tommy

biology
http://www.paternityangel.com/Articles_zone/Blood/BloodType2.htm http://209.85.165.104/search?q=cache:EBt1hadaT20J:genetics.web.emory.edu/pdf/factsheet43.pdf+genetics,+blood+type&hl=en&ct=clnk&cd=7&gl=us&ie=UTF-8
Saturday, March 15, 2008 at 3:18pm by GuruBlue

science
http://www.brighthub.com/science/genetics/articles/41927.aspx
Thursday, March 31, 2011 at 7:39pm by Ms. Sue

biology
http://www.dobermann-review.com/info/genetics/punnet_square/psquar2b.jpg
Wednesday, April 14, 2010 at 9:15pm by bobpursley

Biology 101
Please look at some of the following links: http://search.yahoo.com/search?fr=mcafee&p=how+are+meiosis+%26+genetics+related%3F Sra
Monday, October 25, 2010 at 5:19pm by SraJMcGin

Genetics
yes.
Wednesday, November 4, 2009 at 4:03pm by bobpursley

Genetics
Thank you!
Sunday, August 21, 2011 at 7:12pm by Gabe

Genetics/Biology
That doesn't help.
Thursday, March 18, 2010 at 5:20pm by Sonya

genetics
jkn
Monday, September 24, 2007 at 9:30pm by Anonymous

genetics
wxw
Saturday, September 22, 2007 at 10:50pm by xx

genetics
125
Saturday, September 22, 2007 at 10:50pm by Anonymous

Genetics
Whats a homolog?
Monday, November 3, 2008 at 9:46pm by Lena

biology genetics
What is your question?
Sunday, October 16, 2011 at 4:25pm by PsyDAG

psychology
race and genetics.
Wednesday, November 2, 2011 at 9:28pm by bobpursley

Genetics
yay guelph
Sunday, March 6, 2011 at 8:15pm by sam

genetics
More varieties.
Friday, September 27, 2013 at 3:17am by PsyDAG

Science, Genetics
Anyone? :( Please ?
Monday, March 10, 2014 at 4:28pm by Hannah

Science, Genetics
T_T
Monday, March 10, 2014 at 4:28pm by Hannah

Bio Anatomy
http://www.google.com/#hl=en&sclient=psy-ab&q=genetics+of+occipital+lobe+epilepsy&oq=genetics+of+occipital+lobe+epilepsy&aq=f&aqi=&aql=1&gs_nf=1&gs_l=serp.3...1133416.1141538.1.1143637.5.5.0.0.0.0.105.402.4j1.5.0.cqn%2Ccconf%3D0-95%2Cmin_length%3D2.1.11pvdr5I1pU&psj=1&bav=on.2...
Sunday, April 22, 2012 at 1:57pm by Ms. Sue

Genetics
the transcription would stop.
Monday, September 24, 2007 at 12:38pm by bobpursley

scientist
it eliminates the variable of genetics.
Friday, September 10, 2010 at 5:47pm by bobpursley

Science
How are the structures in genetics related?
Tuesday, October 5, 2010 at 9:58pm by Jack

Genetics
I bet your in my class at guelph.
Sunday, March 6, 2011 at 8:15pm by sean

Genetics
I don't get b or c at alll. What are the u's and a's? What are the exclamation points?
Friday, September 2, 2011 at 2:10pm by Tommy

Biology - genetics
Assistance needed.
Thursday, November 24, 2011 at 7:20pm by Writeacher

Genetics 7th
female is dominant
Thursday, December 13, 2012 at 2:08am by Joshua

Genetics
See your later post.
Thursday, March 21, 2013 at 8:15pm by Devron

Genetics
i = 0.0582 ii=0.0009 b) 3
Wednesday, March 27, 2013 at 1:00am by Anonymous

Science, Genetics
-gives up-
Monday, March 10, 2014 at 4:28pm by Hannah

Psych
Let's look at your first four sentences. It is inconsistent << inconsistent with what? to think that behaviors are solely due to our genetic make-up. When it comes to our behaviors we gain it through nature and nature. << is this what you mean? All the behavior ...
Friday, January 30, 2009 at 2:38pm by Ms. Sue

bio : fundamentals of genetics
Dominant:recessive
Sunday, June 1, 2008 at 9:31pm by bobpursley

Genetics
We use more dilute cultures because
Saturday, March 31, 2007 at 10:59am by Anonymous

science
why are karyotypes important tools for genetics?
Tuesday, May 12, 2009 at 5:37pm by Anonymous

6th grade genetics
What is your question?
Tuesday, May 26, 2009 at 9:07pm by Ms. Sue

leeds middle school
monster genetics
Wednesday, December 6, 2006 at 10:26pm by anyae

bilogy(genetics
you need to do a punnett square
Friday, November 5, 2010 at 2:59pm by annonomus

Psychology
What do genetics and evolution mainly involve?
Wednesday, August 1, 2012 at 8:39pm by PsyDAG

Psychology
What are your choices? Is heredity or genetics among them?
Monday, January 27, 2014 at 1:13pm by PsyDAG

genetics
need help with these genetics problems. please help with what you can. thanks: Given that loci A and B in Drosophila are sex-linked and 20 map units apart, what phenotypic frequencies would you expect in male and female offspring resulting from the following crosses? (Assume A...
Monday, September 24, 2007 at 9:30pm by stew

Science, Genetics
Please help me with science genetics questions? Thanks to all who answer. :) 1. Chromosome pairs contain different versions of genes, which are called ________. 2. The process in which body cells are duplicated in order to grow and repair body tissues is called _____________. ...
Monday, March 10, 2014 at 4:28pm by Hannah

science
Is this what you're looking for? http://ghs.gresham.k12.or.us/science/ps/sci/soph/genetics/notes/sexlinked.htm
Tuesday, April 15, 2008 at 7:03pm by Ms. Sue

Psych
CAN SOMEONE REVIEW MY ANSWERS AND TELL ME IF THIS IS CORRECT? Why is it flawed to ask how much of a particular behavior is due to genetics and how much is due to experience? It is inconsistent to think that behaviors are solely due to our genetic make-up. When it comes to our ...
Friday, January 30, 2009 at 2:38pm by SinnerSaved

Sci230
http://www.usoe.k12.ut.us/CURR/SCIENCE/sciber00/7th/genetics/sciber/compare.htm
Wednesday, July 23, 2008 at 10:46pm by Ms. Sue

Genetics
We seem to have no experts in that field who are qualified to help you.
Thursday, November 20, 2008 at 10:53pm by drwls

science
What is a result of scientific research in the field of genetics
Friday, March 19, 2010 at 12:17pm by Melanie

Biology 101
How are meiosis and genetics related?
Monday, October 25, 2010 at 5:19pm by Anita fields

Genetics part b only
answer this question please
Tuesday, April 2, 2013 at 4:34pm by DOPE

biology
Are an organism's characteristics determined only by its genes? Explain. Yes, an organism's characteristics are determined only by It's genes becuase the parents give their offspring genes which determines their characteristics. Is my answer correct? Do I need to expand on ...
Sunday, February 25, 2007 at 6:35pm by franny

8th grade science
Did you do a GOOGLE Search? There is so much on this subject online: 1. (Broken Link Removed) 2. (Wikipedia): http://en.wikipedia.org/wiki/Reproduction 3. (part II of #2): http://en.wikipedia.org/wiki/Asexual_reproduction 4. (Broken Link Removed) 5. (activity): http://www.usoe...
Monday, November 3, 2008 at 10:38pm by SraJMcGin

Please Help Me :( Science: Biology, Genetics!
Please help me with science genetics questions? Thanks to all who answer!! :) 1. Chromosome pairs contain different versions of genes, which are called ________. 2. The process in which body cells are duplicated in order to grow and repair body tissues is called _____________...
Monday, March 10, 2014 at 5:22pm by Hannah

Science
I need help finding out How does genetics benefit medicine?
Sunday, January 13, 2008 at 11:19pm by Zoey

Genetics
emobroyonic? Please check your spelling and repost. Sra
Monday, November 3, 2008 at 9:50pm by SraJMcGin

Genetics
I think its the frequency of the gene this is a Hardy-Weignberg problem Thanks!
Thursday, November 13, 2008 at 3:01pm by Keira

health
you are correct. Genetics plays a strong role in alcoholism
Wednesday, November 19, 2008 at 5:29pm by DanH

science
I am looking for my study guide - what ends translation ( genetics)
Wednesday, March 18, 2009 at 12:24am by sam

6th grade genetics
transferring a gene from one organism to another
Tuesday, May 26, 2009 at 9:07pm by kay

6th grade genetics
I think that would be called heredity.
Tuesday, May 26, 2009 at 9:07pm by Kim

biology
how does the urinary system support reproduction and passing on genetics?
Saturday, June 27, 2009 at 8:00pm by Liz

Genetics
Can chromosome instability cause an individual to be highly susceptible to cancer?
Saturday, October 3, 2009 at 6:47pm by Sarah

Genetics
Sorry, not value.. I need an approximate length... in Angstroms.
Monday, October 31, 2011 at 1:23am by Kyle

early childhood
evolutionary psychology and behavior genetics: watson
Thursday, February 23, 2012 at 3:45pm by jen

genetics
Also, how would this affect the connection of DNA and the histones?
Sunday, October 14, 2012 at 7:31pm by ren

Genetics
Please give the genotypes of the parents here, so we can respond.
Friday, November 23, 2012 at 11:06am by PsyDAG

Genetics
this is validation of EDX course.. do problem sets yourself! cheater!
Thursday, March 21, 2013 at 2:39am by fungus

biology - genetics
is the cis-regulatory sequence found in the exome?
Wednesday, March 26, 2014 at 2:01am by santoki

Genetics
what is the chance of a woman having five female children in a row?
Wednesday, January 9, 2008 at 3:58pm by Matthew

human Genetics
In a mouse cell at the start of mitosis, how many chromatids are present?
Thursday, September 15, 2011 at 9:59pm by kay

Genetics
In general, what two methods are used to grow bacteria in the laboratory?
Wednesday, February 8, 2012 at 10:12am by Anon

SCIENCE (GENETICS)
if there are two forms of each of the seven traits, how many possible combinations are there?
Wednesday, May 23, 2012 at 10:41pm by JEN

Biology - genetics
How does crossing over change the combination of alleles in gametes? Thanks :)
Thursday, August 23, 2012 at 3:01am by Cally

genetics
What kinds of amino acids on histone tails are able to be phosphorylated and why?
Sunday, October 14, 2012 at 7:31pm by ren

genetics
check my thinking. Parent one is homozygous in dominant, and parent two is homozygous in recessive. Therefore F1 cannot be anything but heterozygous.( AaBbCcDdEe), one genotype. Now in F2, each parent will contribute either dominant or recessive, so there are three types in ...
Friday, September 12, 2008 at 1:18pm by bobpursley

genetics
What would happen during DNA replication if there were no thymine nucleotides available?
Wednesday, October 28, 2009 at 10:07pm by sam

genetics
Adenine would not have a bonding partner. Tell me more please.
Wednesday, October 28, 2009 at 10:07pm by BranditoOeste

7th grade science
Why was Gregor Mendel given the title "The Father Of Genetics" ?
Sunday, December 13, 2009 at 6:26pm by mary

Genetics
The following DNA segment has one ORF. Do you know what it codes for? 5'-TAGGATGTTCGACATGTAAGCTT ATCCTACAAGCTGTACATTCGAA
Thursday, November 10, 2011 at 3:08am by Tony

Pages: 1 | 2 | 3 | 4 | 5 | Next>>

Search
Members