February 27, 2017

Search: Translation

Number of results: 642

Spanish Check
Hi! Can someone check these for me? Thanks! Directions: Label each sentence with the correct tense they are in. They translate it into full Spanish. 1.) I will study. (Future) (Translation: Estudiare) 2.) Mom made tacos. (Present) (Translation: Mama hizo tacos) 3.) I’m happy...
May 19, 2015 by Abby

The vertices of a rectangle are R(-5,-5), S(-1,-5), T(-1,1), and U(-5,1). After translation, R prime is the point (0,-13). Find the translation vector and coordinates of U prime. I got (5,-8) as my translation vector and (0,-7) as U prime. Is this right?
November 23, 2007 by keisha

Which transformation moves the figure from position A to position B? then it shows a picture of a heart like one that's facing u and the other one is sideways. is the answer a-rotation, b-reflection, c translation d-rotation and translation, i think its d also what does ...
April 15, 2012 by Gabby ( 5 grade)

A bicycle and rider travel along a road. Which of the following statements is true? a. Only the rider undergoes a translation. b. Only the bicycle undergoes translation. c. Neither the bicycle nor the rider undergoes a translation. D. The bicycle and rider undergo translation
September 30, 2016 by MM

A translation has this rule:(x-5,y). Fill in the answers This translation is (how many) Units (in what direction) Answer:
March 11, 2009 by MAtt

A translation maps (-6,2) onto (-4,-2). Find the image of (3,5) under the same translation.
February 24, 2010 by Tyler

Can somebody help me find a site for a FREE English-Cebuano translation??? Urgent please!!!
November 23, 2008 by klarmaesen

The vertices of a rectangle are R(–5, –5), S(–1, –5), T(–1, 1), and U(–5, 1). After translation, R' is the point (–11, –11). Find the translation rule and coordinates of U'.
December 16, 2011 by Cindy

A point (-5, 4) is mapped onto (-1, -1) by a translation. Find the image of (-4, 5) under the same translation.
February 22, 2015 by kudu

A point (-5, 4) is mapped onto (-1, -1) by a translation. Find the image of (-4, 5) under the same translation.
March 14, 2015 by kudu

It's been more than 24 hours and no answer...
A translation has this rule:(x-5,y). Fill in the answers This translation is (how many) Units (in what direction)
March 13, 2009 by Brian

Trig FInd Translation Rule and Coordinates Thanks!
The vertices of a rectangle are R(–5, –5), S(–1, –5), T(–1, 1), and U(–5, 1). After translation, R' is the point (–11, –11). Find the translation rule and coordinates of U'. (x, y)--> (x – 6, y + 6); (–11, 7) (x, y)--> (x – 6, y – 6); (–11, –5...
March 1, 2012 by LeXi ;)

What results from the composition of reflections in two parallel lines? a. glide reflection b. dilation c. rotation d. translation Would the correct answer be d. translation?
April 30, 2009 by Anonymous

I am in a translation class and the sentence contains this phrase can you tell me what it means The city was brutal in its reaction wiping 50 3/4p off the share price what does 50 3/4p stand for
November 2, 2011 by John

Figures that correspond under a translation, rotation, or reflection are said to be translation congruent, rotation congruent, or reflection congruent. Position two congruent figures on a piece of paper to satisfy each combination of congruences listed. Use tracing paper, ...
August 28, 2009 by Anonymous

Figures that correspond under a translation, rotation, or reflection are said to be translation congruent, rotation congruent, or reflection congruent. Position two congruent figures on a piece of paper to satisfy each combination of congruences listed. Use tracing paper, ...
October 24, 2009 by jeng

Algebra II
This deals with quadratic functions-If I have a graph with points h=-5, k =3 and they ask for the translation, would it be {5,3} or would the translation just be {-5,3}
September 21, 2010 by Tom

What is the translation of "Comment s'appelle ce terrain de camping"? I know that the literal translation is, "How do you call camping"? but that makes no sense to me.
May 25, 2013 by Erika

Use a translation rule to describe the translation of triangle ABC that is 8 units to the right and 2 units down.
March 26, 2014 by Libby

Describe the transformation that changes triangle ABC to triangle A'B'C A:Rotation B:Translation C:Reflection D: None of the above I am almost positive it is a translation
January 19, 2017 by Reeces

RSV has coordinates R(2,1),S(3,2), and V(2,6). A translation maps points R to R' at (-4,8). What are the coordinates for S' for this translation? Can't understand this one please help me.
December 16, 2011 by Cindy

Write a translation rule that maps point D(7,-3) onto point D(2,5) Please help I don't understand how to do translation I graph the number down but didn't know the next step.
November 16, 2016 by Lexa Reed

Is one flag a translation image of the other, or rotation image? Explain. is is translation?
May 24, 2016 by cassie

A bicycle and rider travel along a road. Which of the following statements is true? Neither the bicycle nor the rider undergoes a translation. Only the bicycle undergoes a translation. The bicycle wheels rotate and translate the entire bike and the rider. Only the bicycle ...
January 15, 2015 by Ali

cCongruence and transformations?
m (x,y) --> (-x,y) is what transformation reflection rotation or translation m (x,y) --> (y, -x) is what transformation reflection rotation or translation m (x,y) --> (2x,2y) is what transformation reflection rotation or translation how do you do this what are some ...
August 27, 2013 by loli

how do the graphs of y=1/x and y=3/x-4 compare? a) compared to the graph of f=1/x the grapg of y=3/x-4 is vertical stretch by factor of 3 and a translation of 4 units left b) compared to the graph of y=1/x the graph of 3/x-4 is a vertical shrink by a factor of 3 and ...
January 19, 2013 by lee

4th grade Science
My daughter is learning translation and rotation in science right now...what is translation in regards to science?
November 3, 2008 by Katie

1. The process by which the ER uptakes an incipient polypetide concurrent with treanslation of the peptide is called..... a. co-import translation b. co- translation import c. co-transcription import d. co-transprt d;lskf;ldsakf;lsdkf'akf;ldsafsdfsdfsdafsa
July 31, 2006 by Tammy Levvy

1.Which translation rule describes the translation that is 6 units to the right and 5 units down? A.(x, y)--> (x+6, y-5)**** B.(x, y)--> (x-6, y-5) C.(x, y)--> (x+6, y+5) D.(x, y)--> (x-6, y+5) 2.If point P(4,11) is reflected across the line y=3, what are the ...
December 7, 2016 by GummyBears18

1.Which translation rule describes the translation that is 6 units to the right and 5 units down? A.(x, y)--> (x+6, y-5)**** B.(x, y)--> (x-6, y-5) C.(x, y)--> (x+6, y+5) D.(x, y)--> (x-6, y+5) 2.If point P(4,11) is reflected across the line y=3, what are the ...
December 8, 2016 by GummyBears16

HIV is a retrovirus. Which of the following processes does it use to synthesize a DNA strand using its own RNA genome as a template? *reverse translation *reverse transcription-------- *translation *transcription
February 16, 2014 by Kia

after 30 seconds of translation you treat a cell with a chemical that blocks the P site on the ribosome so that it does not function anymore. describe what was happening prior to the treatment of the ribosome, and what would happen after the treatment of the ribosome. defend ...
April 29, 2007 by cookie

A snow cone has {1} line of symmetry. A slide of a figure along a straight line- my answer: translation an object moved to the right and up- my answer: diagonal translation are these correct?? I would appreciate any and all help Thank You.
February 28, 2012 by running.from.myself

Children Development
The name and contact information of a translation service for families whose home language is other than English as well a service that provides American Sign Language Translation? I need help find a website for this two things?
December 13, 2015 by Anonymous

Math help Please
2. How do the graphs of y = 1/x and y = 3/x – 4 compare? (1 point) Compared to the graph of y = 1/x, the graph of y = 3/x – 4 is a vertical stretch by a factor of 3 and a translation of 4 units left. Compared to the graph of y = 1/x, the graph of y = 3/x – 4 is a ...
January 9, 2014 by Cassie

The vertices of a rectangle are R(-5,-5), S(-1,-5), T(-1,1),and U(-5,1). After translation, R prime is the point (0,-13). Find the translation vector and coordinates of U prime. I got (5,-8) as my tanslatipn vector and (0,-7) as my U prime. Is this right?
November 24, 2007 by keisha

What is this in Spanish: You get dressed at 8 o'clock. Te vistes a las ocho. ? Is this the correct translation? If not, then what is the correct translation?
May 3, 2010 by Aly

geometry help!! answer all questions!! please
1) Write the translation that maps P(-4, 2) onto the point P ' (-1, -1)? 2) What are the coordinates of the reflection of the point (5,1) over the line y = x? 3) The coordinate notation for reflection over the y-axis is -?-. 4) If a translation has a coordinate notation of (x...
July 31, 2014 by Lulu

Is one flag a translation of the other, or a rotation image? Please explain looks like the flag is the same above the line as it is below the line. I think translation but not sure how to explain.
March 13, 2012 by kevin

Two points P and Q have coordinates (-2, 3) and (1, 3) respectively. A translation map point P to P’ (10, 10) (a) Find the coordinates of Q’ the image of Q under the translation (b) The position vector of P and Q in (a) above are p and q respectively given that mp – nq...
March 14, 2015 by kudu

Write the translation that maps P(-4, 2) onto the point P ' (-1, -1)? What are the coordinates of the reflection of the point (5,1) over the line y = x? The coordinate notation for reflection over the y-axis is -?-. If a translation has a coordinate notation of (x, y) -->(x...
July 31, 2014 by Diamond

Algebra--Math matePlease help
Homework Help Forum: Algebra-Please help-I'm confused Posted by Tom on Tuesday, September 21, 2010 at 8:09pm. This deals with quadratic functions-If I have a graph with h = (-5)and k =3 and they ask for the translation, would it be {5,3} or would the translation just be {-5,3...
September 22, 2010 by Tom

Quick algebra help
What would this look like if a write a function g whose graph represents the indicated transformation of the graph of f? 1. f(x)= |x| translation of 5 units left and 2 units up 2. f(x)=x^2; reflection in the c axis and translation 8 units left
September 23, 2015 by Hannah

Algebra 2
2. How do the graphs of y = 1/x and y = 3/x – 4 compare? (1 point) Compared to the graph of y = 1/x, the graph of y = 3/x – 4 is a vertical stretch by a factor of 3 and a translation of 4 units left. Compared to the graph of y = 1/x, the graph of y = 3/x – 4 is a ...
January 9, 2014 by Cassie

Find equations for a pair of lines M and N so R(sub n)compose R(sub m) is the given transformation. A. The translation that maps the origin onto (5,0) B. The rotation of 180o about a point (Xo, Yo) C. The rotation of 40o about the origin D. The translation T with T(x,y) = (x+3...
June 19, 2013 by Stace

Translation with vectors
Thanks for reading this! A triangular prism has vertices at A(2,-1,-1) B(2,1,4) C(2,2,-1) D(-1,-1,-1) E(-1,1,4), and F(-1,2,-1)? This question has two parts: 1 - Which image point has the coordinates (-3,2,1) after a translation using the vector <-5,1,3> I'm thinking it'...
April 26, 2012 by For Reiny

At a halftime show a matching band marched in formation. The lead drummer started at a point with coordinates (-2,-5) and moved 3 steps up and 1 step right. A. Write a rule to describe the translation B. What were the coordinates of the drummers final position? A: Write a rule...
November 8, 2015 by Anonymous

Does anyone have the superior knowledge as to where I could find an easy read translation of Romeo and Juliet for no price at all on the Internet?? Thank you for your valuable time and wonderful guiness. you could just read spark notes summaries Thank you for using the Jiskha ...
February 22, 2007 by Caroline

HELP Not great in these Express y=2x^2 -12x +23 in the form y=2(x-c)^2 + d The graph of y=x^2 is transformed into the graph of y=2x^2 - 12x +23 by the transformation a vertical stretch with scale factor k followed by, A horizontal translation of p units followed by, a vertical...
December 10, 2010 by Morie

Algebra-Please help-I'm confused
This deals with quadratic functions-If I have a graph with h = (-5)and k =3 and they ask for the translation, would it be {5,3} or would the translation just be {-5,3} Do you take the opposite of the number when it is transalated from the graph or do you only take the opposite...
September 21, 2010 by Tom

For question 10 here: I have these answer choices: a. glide reflection symmetry b. no symmetry c. glide reflection and translation symmetry d. translation symmetry Is answer C correct?
April 2, 2015 by Anonymous

This deals with quadratic functions-If I have a graph with he = (-5)and k =3 and they ask for the translation, would it be {5,3} or would the translation just be {-5,3} Do you take the opposite of the number when it is transalated from the graph or do you only take the ...
September 21, 2010 by Tom

Which of the following is NOT true of transcription / translation processes in both bacteria and eukaryotes? Select one: a. RNA polymerase reads the template DNA strand to produce the complementary mRNA transcript. b. Translation of a polypeptide can occur before transcription...
November 25, 2013 by bobby

For membrane-associated proteins, the consensus sequence _______ is found on the inchoate (new) polypeptide and ______ to halt. a. pribnow, replication b. signal peptidase, transcription c. stop-transfer peptide, transcription d. stop-transfer sequence, translation e. stop-...
July 31, 2006 by Josh

For membrane-associated proteins, the consensus sequence _______ is found on the inchoate (new) polypeptide and ______ to halt. a. pribnow, replication b. signal peptidase, transcription c. stop-transfer peptide, transcription d. stop-transfer sequence, translation e. stop-...
August 1, 2006 by Sarah

Verify if this is the correct form please. Given the parent function f(x)=log[10]x, state the equation of the function that results from a vertical stretch by a factor of 2/5, a horizontal stretch by a factor of 3/4, a reflection in the y-axis, a horizontal translation 2 units...
January 30, 2012 by Lea

Construct the equations of the following trigonometric functions: A)A sine function with amplitude 2, period , phase shift /3 right B)A tangent function with a reflection in the y-axis, period ¾, translation up 5 units C)A cosine function with period 270°, translation down ...
June 11, 2012 by darshi

Construct the equations of the following trigonometric functions: A)A sine function with amplitude 2, period , phase shift /3 right B)A tangent function with a reflection in the y-axis, period ¾, translation up 5 units C)A cosine function with period 270°, translation down ...
August 12, 2012 by Christina

y=10(0.5)^(t/19.74) My question: is this a horizontal stretch by a factor of 19.74? y=10(0.5)^(8t) My question: is this a horizontal compression by a factor of 1/8? y=10(0.5)^x + 1 My question: is this a vertical translation of up 1 unit? y=10(0.5)^(x-1) My question: is this a...
May 19, 2009 by Jus

Algebra 1
Describe the effect of the transformation. (x,y)--->(x,-7y) A. Vertical translation of -7 units. B. Vertical stretch without reflection C. Horizontal translation of -7 units D. Vertical stretch without reflection Is the answer A
November 9, 2013 by Gayle

Math: Line Symmetry and Reflection
1. The point c(x,y) is reflected over the x-axis. Use arrow notations to describe the original point and its reflection. a. (x,y) --> (x,2y) b. (x,y) --> (-x,y) c. (x,y) --> (-x,-y) d. (x,y) --> (x,-y) ** 2. What is the correct description for the translation of A ...
May 13, 2015 by Jazmine

A triangle is reflected across line L and then across line m. If the lines intersect, what kind of isometry is this composition of reflections? translation rotation reflection glide reflection*****? After a glide reflection, the point x is mapped to the point x' (3, -2). The ...
November 18, 2015 by SkatingDJ

math 214
Answer each of the following: a. Draw a line l’ and any two points A and B so that AB is parallel to the line. Find the image of l under a translation from A to B. b. Draw a line l and any two points A and B so that AB is not parallel to l. Construct l’, the image of l ...
December 21, 2009 by brina

Describe in words the translation of X represented by the translation rule T < -7, -8 > (X). A. 7 units to the right and 8 units up B. 8 units to the left and 7 units up C. 7 units to the right and 8 units down D. 7 units to the left and 8 units down***** If I am wrong, ...
March 23, 2016 by Carpe_Diem

Question 1.1. For each of the following questions, choose the correct answer. What is another word for rotation? (Points : 1) flip turn slide fall Question 2.2. What's another word for a translation? (Points : 1) flip turn slide fall Question 3.3. Maria slides a triangle two ...
September 13, 2014 by Ash

Question 1.1. For each of the following questions, choose the correct answer. What is another word for rotation? (Points : 1) flip turn slide fall Question 2.2. What's another word for a translation? (Points : 1) flip turn slide fall Question 3.3. Maria slides a triangle two ...
September 13, 2014 by Ash

Given the parent function f(x)log(base10)x, state the equation of the function that results from a vertical stretch by a factor of 2/5, a horizontal stretch by a factor of 3/4, a reflection in the y-axis , a horizontal translation 2 units to the right, and a vertical ...
January 29, 2012 by Melinda

Given the parent function f(x)log(base10)x, state the equation of the function that results from a vertical stretch by a factor of 2/5, a horizontal stretch by a factor of 3/4, a reflection in the y-axis , a horizontal translation 2 units to the right, and a vertical ...
January 30, 2012 by Melinda

I appreciate any help you can give me. Here is my question: Find the coordinates of the images of A(2,3), and B(-2,3) under the following transformations. Assume that all size transformations are centered at the origin. a. A size transformation with scale factor 2 followed by ...
April 17, 2013 by Christine

Spanish Song Translation
Can someone please translate the last two stanzas of "Bonito" by Jarabe de Palo? I tried translating it but couldn't and so I tried to find a good translation that looked like a human and not a translator did it, but that didn't work out either. So now I'm stuck. Please help ...
October 31, 2009 by Suchindram

"Do you know the requirements?" Which translation is appropriate for the above question: 1. Conoces alquien con estos calificacones? 1. Conoces alguien que puede llenar estos requisitos? Thanks! Or am I totally off! Thank you for using the Jiskha Homework Help Forum. Actually...
April 13, 2007 by jules

A sequence of transformations is applied to triangle MNO to create triangle M'N'O'. * Select all the sequences of transformation that could be applied to to triangle MNO so that triangle MNO ≅ M'N'O (3 answers) A. a clockwise rotation of 90 degrees and then a dilation by a ...
November 17, 2016 by Help me please

16 less than q, what is the translation?
April 6, 2010 by renee

Algebra 1a
8 Increased by b The translation is
April 8, 2012 by Dede

What is the translation of 24 increased by y??
October 26, 2014 by Bobbie

which pair of transformations to the figure shown below would produce an image that is on top of the original A. a translation to the right and a reflection over the vertical line of reflection shown. B. a translation down and a reflection over the horizontal line of ...
March 11, 2016 by KeyKat

which pair of transformations to the figure shown below would produce an image that is on top of the original A. a translation to the right and a reflection over the vertical line of reflection shown. B. a translation down and a reflection over the horizontal line of ...
March 11, 2016 by heidi/KeyKat

Prisilla performs a series of transformations on a figure in the plane. First she dilates it by a factor of 3 and translates it 5 units to the right. Next she reflects it over the x axis, then over the y axis. Finally she reflects it over the line y=x, translate it 5 units to ...
February 9, 2008 by bob

translation: 23 less than d is it 23 - d or -23d
September 21, 2009 by Anonymous

what is anterior tibial translation?
July 27, 2012 by Carla

translation of the quotient of 100 and w
August 30, 2015 by ethan

translation of 12 less than 15 time x
August 30, 2015 by ethan

translation for y less than 18 times 6
August 30, 2015 by ethan

A triangular pyramid is defined by the points .The pyramid is then reflected over the xz-plane. The reflected image is then translated 3 units back, 2 units left, and 4 units up. Write the general rule you use for the reflection. Show the results of your calculations for the ...
March 11, 2016 by Jessica

Verify these answers please. 1. Which of the following functions would f(x) = log(base 10)x horizontally 4 units to the left? a) f(x)=log(base10)(x-4) b) f(x)=4Log(base10)X c) f(x)=log(base10) x+4 Answer: C ------------------------------------ 2. State the transformations, in ...
January 29, 2012 by Melinda

A sequence of transformations is applied to triangle MNO to create triangle M'N'O'. Select all that apply Select all the sequences of transformations that could be applied to triangle MNO so that triangle MNO (equal sign with "~" over it) M'N'O (3 answers) A. a clockwise ...
November 17, 2016 by Lol

The sequence below begins with the initiator methione. ATGTTCAATGTTATGGATTGGCCCTGGTAAATGAAATAGAATGAT Please give a hypothetical (translation of cDNA sequence into single amino acid codes if there is a C deletion in the phenylalanine codon _4pts.(Please give a hypothetical ...
September 24, 2013 by aisha

Having some trouble with articles. When would I use 'los/las' and 'unos/unas' Example: Rewrite these sentences changing the words in brackets to the plural. 1. (El es un hombre) de Bariloche Ellos son unos hombre de Bariloche. Would not 'los' sound more correct instead of '...
February 11, 2009 by Larry

translation for acts like a hotdog
October 2, 2009 by Anonymous

what is a translation over a vertical line?
April 9, 2012 by tiana

Apply a translation up 6 units to the following F(x)- -6x-10
December 10, 2013 by Hannah

Apply a translation up 6 units to the following F(x)- -6x-10
December 10, 2013 by Anonymous

In what part of the cell does translation occur?
April 24, 2014 by Miguel

Algebra 2
Write an equation for the translation of y=5/x that has the asymptotes x=6 and y=7.
May 24, 2014 by Caleb

Algebra 2
what is an equation for each vertical translation of y=2x-1: 3/5 units up f) y=2x-2/5 g) y=2x-1/5 h) y=2x-8/5 I) y=2x+1/5
September 16, 2014 by Alice

Algebra 2
what is an equation for the vertical translation of y=2x-1: 3/5 units up f) y=2x-2/5 g) y=2x-1/5 h) y=2x-8/5 I) y=2x+1/5
September 16, 2014 by Alice

Algebra 1
Write an equation for then translation of y = IXI
December 13, 2014 by Steve

Prisilla performs a series of transformations on a figure in the plane. First she dilates it by a factor of 3 and translates it 5 units to the right. Next she reflects it over the x axis, then over the y axis. Finally she reflects it over the line y=x, translate it 5 units to ...
February 9, 2008 by bob

Spanish translation
El maistra es una aficionado el beisbol.
September 25, 2007 by Anonymous

is there anywhere that i can get a translation of some problem words? <3
October 28, 2007 by chelsea

  1. Pages:
  2. 1
  3. 2
  4. 3
  5. 4
  6. 5
  7. 6
  8. 7
  9. Next>>