Tuesday
November 25, 2014

Search: Translation

Number of results: 521

math
The vertices of a rectangle are R(-5,-5), S(-1,-5), T(-1,1), and U(-5,1). After translation, R prime is the point (0,-13). Find the translation vector and coordinates of U prime. I got (5,-8) as my translation vector and (0,-7) as U prime. Is this right?
November 23, 2007 by keisha

math
Which transformation moves the figure from position A to position B? then it shows a picture of a heart like one thats facing u and the other one is sideways. is the answer a-rotation, b-reflection, c translation d-rotation and translation, i think its d also what does ...
April 15, 2012 by Gabby ( 5 grade)

Math
A translation has this rule:(x-5,y). Fill in the answers This translation is (how many) Units (in what direction) Answer:
March 11, 2009 by MAtt

Trigonometry
A translation maps (-6,2) onto (-4,-2). Find the image of (3,5) under the same translation.
February 24, 2010 by Tyler

translation
Can somebody help me find a site for a FREE English-Cebuano translation??? Urgent please!!!
November 23, 2008 by klarmaesen

geometry
The vertices of a rectangle are R(5, 5), S(1, 5), T(1, 1), and U(5, 1). After translation, R' is the point (11, 11). Find the translation rule and coordinates of U'.
December 16, 2011 by Cindy

It's been more than 24 hours and no answer...
A translation has this rule:(x-5,y). Fill in the answers This translation is (how many) Units (in what direction)
March 13, 2009 by Brian

Trig FInd Translation Rule and Coordinates Thanks!
The vertices of a rectangle are R(5, 5), S(1, 5), T(1, 1), and U(5, 1). After translation, R' is the point (11, 11). Find the translation rule and coordinates of U'. (x, y)--> (x 6, y + 6); (11, 7) (x, y)--> (x 6, y 6); (11, 5) (x, y)--> (x + 6, y 6...
March 1, 2012 by LeXi ;)

Geometry
What results from the composition of reflections in two parallel lines? a. glide reflection b. dilation c. rotation d. translation Would the correct answer be d. translation?
April 30, 2009 by Anonymous

Translation
I am in a translation class and the sentence contains this phrase can you tell me what it means The city was brutal in its reaction wiping 50 3/4p off the share price what does 50 3/4p stand for
November 2, 2011 by John

MATH
Figures that correspond under a translation, rotation, or reflection are said to be translation congruent, rotation congruent, or reflection congruent. Position two congruent figures on a piece of paper to satisfy each combination of congruences listed. Use tracing paper, ...
August 28, 2009 by Anonymous

geometry
Figures that correspond under a translation, rotation, or reflection are said to be translation congruent, rotation congruent, or reflection congruent. Position two congruent figures on a piece of paper to satisfy each combination of congruences listed. Use tracing paper, ...
October 24, 2009 by jeng

Algebra II
This deals with quadratic functions-If I have a graph with points h=-5, k =3 and they ask for the translation, would it be {5,3} or would the translation just be {-5,3}
September 21, 2010 by Tom

French
What is the translation of "Comment s'appelle ce terrain de camping"? I know that the literal translation is, "How do you call camping"? but that makes no sense to me.
May 25, 2013 by Erika

Math
Use a translation rule to describe the translation of triangle ABC that is 8 units to the right and 2 units down.
March 26, 2014 by Libby

geometry
RSV has coordinates R(2,1),S(3,2), and V(2,6). A translation maps points R to R' at (-4,8). What are the coordinates for S' for this translation? Can't understand this one please help me.
December 16, 2011 by Cindy

cCongruence and transformations?
m (x,y) --> (-x,y) is what transformation reflection rotation or translation m (x,y) --> (y, -x) is what transformation reflection rotation or translation m (x,y) --> (2x,2y) is what transformation reflection rotation or translation how do you do this what are some ...
August 27, 2013 by loli

algebra
how do the graphs of y=1/x and y=3/x-4 compare? a) compared to the graph of f=1/x the grapg of y=3/x-4 is vertical stretch by factor of 3 and a translation of 4 units left b) compared to the graph of y=1/x the graph of 3/x-4 is a vertical shrink by a factor of 3 and ...
January 19, 2013 by lee

4th grade Science
My daughter is learning translation and rotation in science right now...what is translation in regards to science?
November 3, 2008 by Katie

BIO
1. The process by which the ER uptakes an incipient polypetide concurrent with treanslation of the peptide is called..... a. co-import translation b. co- translation import c. co-transcription import d. co-transprt d;lskf;ldsakf;lsdkf'akf;ldsafsdfsdfsdafsa
July 31, 2006 by Tammy Levvy

Science
HIV is a retrovirus. Which of the following processes does it use to synthesize a DNA strand using its own RNA genome as a template? *reverse translation *reverse transcription-------- *translation *transcription
February 16, 2014 by Kia

genetics
after 30 seconds of translation you treat a cell with a chemical that blocks the P site on the ribosome so that it does not function anymore. describe what was happening prior to the treatment of the ribosome, and what would happen after the treatment of the ribosome. defend ...
April 29, 2007 by cookie

math
A snow cone has {1} line of symmetry. A slide of a figure along a straight line- my answer: translation an object moved to the right and up- my answer: diagonal translation are these correct?? I would appreciate any and all help Thank You.
February 28, 2012 by running.from.myself

Math help Please
2. How do the graphs of y = 1/x and y = 3/x 4 compare? (1 point) Compared to the graph of y = 1/x, the graph of y = 3/x 4 is a vertical stretch by a factor of 3 and a translation of 4 units left. Compared to the graph of y = 1/x, the graph of y = 3/x 4 is a vertical ...
January 9, 2014 by Cassie

math
The vertices of a rectangle are R(-5,-5), S(-1,-5), T(-1,1),and U(-5,1). After translation, R prime is the point (0,-13). Find the translation vector and coordinates of U prime. I got (5,-8) as my tanslatipn vector and (0,-7) as my U prime. Is this right?
November 24, 2007 by keisha

Spanish
What is this in Spanish: You get dressed at 8 o'clock. Te vistes a las ocho. ? Is this the correct translation? If not, then what is the correct translation?
May 3, 2010 by Aly

geometry help!! answer all questions!! please
1) Write the translation that maps P(-4, 2) onto the point P ' (-1, -1)? 2) What are the coordinates of the reflection of the point (5,1) over the line y = x? 3) The coordinate notation for reflection over the y-axis is -?-. 4) If a translation has a coordinate notation of (x...
July 31, 2014 by Lulu

geometry
Is one flag a translation of the other, or a rotation image? Please explain looks like the flag is the same above the line as it is below the line. I think translation but not sure how to explain.
March 13, 2012 by kevin

Geometry
Write the translation that maps P(-4, 2) onto the point P ' (-1, -1)? What are the coordinates of the reflection of the point (5,1) over the line y = x? The coordinate notation for reflection over the y-axis is -?-. If a translation has a coordinate notation of (x, y) -->(...
July 31, 2014 by Diamond

Algebra--Math matePlease help
Homework Help Forum: Algebra-Please help-I'm confused Posted by Tom on Tuesday, September 21, 2010 at 8:09pm. This deals with quadratic functions-If I have a graph with h = (-5)and k =3 and they ask for the translation, would it be {5,3} or would the translation just be {-5,3...
September 22, 2010 by Tom

Algebra 2
2. How do the graphs of y = 1/x and y = 3/x 4 compare? (1 point) Compared to the graph of y = 1/x, the graph of y = 3/x 4 is a vertical stretch by a factor of 3 and a translation of 4 units left. Compared to the graph of y = 1/x, the graph of y = 3/x 4 is a vertical ...
January 9, 2014 by Cassie

Math
Find equations for a pair of lines M and N so R(sub n)compose R(sub m) is the given transformation. A. The translation that maps the origin onto (5,0) B. The rotation of 180o about a point (Xo, Yo) C. The rotation of 40o about the origin D. The translation T with T(x,y) = (x+3...
June 19, 2013 by Stace

Translation with vectors
Thanks for reading this! A triangular prism has vertices at A(2,-1,-1) B(2,1,4) C(2,2,-1) D(-1,-1,-1) E(-1,1,4), and F(-1,2,-1)? This question has two parts: 1 - Which image point has the coordinates (-3,2,1) after a translation using the vector <-5,1,3> I'm thinking it'...
April 26, 2012 by For Reiny

English
Does anyone have the superior knowledge as to where I could find an easy read translation of Romeo and Juliet for no price at all on the Internet?? Thank you for your valuable time and wonderful guiness. you could just read spark notes summaries Thank you for using the Jiskha ...
February 22, 2007 by Caroline

math
HELP Not great in these Express y=2x^2 -12x +23 in the form y=2(x-c)^2 + d The graph of y=x^2 is transformed into the graph of y=2x^2 - 12x +23 by the transformation a vertical stretch with scale factor k followed by, A horizontal translation of p units followed by, a vertical...
December 10, 2010 by Morie

Algebra-Please help-I'm confused
This deals with quadratic functions-If I have a graph with h = (-5)and k =3 and they ask for the translation, would it be {5,3} or would the translation just be {-5,3} Do you take the opposite of the number when it is transalated from the graph or do you only take the opposite...
September 21, 2010 by Tom

Algebra
This deals with quadratic functions-If I have a graph with he = (-5)and k =3 and they ask for the translation, would it be {5,3} or would the translation just be {-5,3} Do you take the opposite of the number when it is transalated from the graph or do you only take the ...
September 21, 2010 by Tom

biology
Which of the following is NOT true of transcription / translation processes in both bacteria and eukaryotes? Select one: a. RNA polymerase reads the template DNA strand to produce the complementary mRNA transcript. b. Translation of a polypeptide can occur before transcription...
November 25, 2013 by bobby

CellBiology
For membrane-associated proteins, the consensus sequence _______ is found on the inchoate (new) polypeptide and ______ to halt. a. pribnow, replication b. signal peptidase, transcription c. stop-transfer peptide, transcription d. stop-transfer sequence, translation e. stop-...
July 31, 2006 by Josh

Biochem
For membrane-associated proteins, the consensus sequence _______ is found on the inchoate (new) polypeptide and ______ to halt. a. pribnow, replication b. signal peptidase, transcription c. stop-transfer peptide, transcription d. stop-transfer sequence, translation e. stop-...
August 1, 2006 by Sarah

Math
Verify if this is the correct form please. Given the parent function f(x)=log[10]x, state the equation of the function that results from a vertical stretch by a factor of 2/5, a horizontal stretch by a factor of 3/4, a reflection in the y-axis, a horizontal translation 2 units...
January 30, 2012 by Lea

math
Construct the equations of the following trigonometric functions: A)A sine function with amplitude 2, period , phase shift /3 right B)A tangent function with a reflection in the y-axis, period , translation up 5 units C)A cosine function with period 270, translation down 50 ...
June 11, 2012 by darshi

trig
Construct the equations of the following trigonometric functions: A)A sine function with amplitude 2, period , phase shift /3 right B)A tangent function with a reflection in the y-axis, period , translation up 5 units C)A cosine function with period 270, translation down 50...
August 12, 2012 by Christina

pre-calc
y=10(0.5)^(t/19.74) My question: is this a horizontal stretch by a factor of 19.74? y=10(0.5)^(8t) My question: is this a horizontal compression by a factor of 1/8? y=10(0.5)^x + 1 My question: is this a vertical translation of up 1 unit? y=10(0.5)^(x-1) My question: is this a...
May 19, 2009 by Jus

Algebra 1
Describe the effect of the transformation. (x,y)--->(x,-7y) A. Vertical translation of -7 units. B. Vertical stretch without reflection C. Horizontal translation of -7 units D. Vertical stretch without reflection Is the answer A
November 9, 2013 by Gayle

math 214
Answer each of the following: a. Draw a line l and any two points A and B so that AB is parallel to the line. Find the image of l under a translation from A to B. b. Draw a line l and any two points A and B so that AB is not parallel to l. Construct l, the image of l under ...
December 21, 2009 by brina

geometry
Question 1.1. For each of the following questions, choose the correct answer. What is another word for rotation? (Points : 1) flip turn slide fall Question 2.2. What's another word for a translation? (Points : 1) flip turn slide fall Question 3.3. Maria slides a triangle two ...
September 13, 2014 by Ash

math
Question 1.1. For each of the following questions, choose the correct answer. What is another word for rotation? (Points : 1) flip turn slide fall Question 2.2. What's another word for a translation? (Points : 1) flip turn slide fall Question 3.3. Maria slides a triangle two ...
September 13, 2014 by Ash

Precalculus
Given the parent function f(x)log(base10)x, state the equation of the function that results from a vertical stretch by a factor of 2/5, a horizontal stretch by a factor of 3/4, a reflection in the y-axis , a horizontal translation 2 units to the right, and a vertical ...
January 29, 2012 by Melinda

Precalculus
Given the parent function f(x)log(base10)x, state the equation of the function that results from a vertical stretch by a factor of 2/5, a horizontal stretch by a factor of 3/4, a reflection in the y-axis , a horizontal translation 2 units to the right, and a vertical ...
January 30, 2012 by Melinda

Geometry
I appreciate any help you can give me. Here is my question: Find the coordinates of the images of A(2,3), and B(-2,3) under the following transformations. Assume that all size transformations are centered at the origin. a. A size transformation with scale factor 2 followed by ...
April 17, 2013 by Christine

Spanish Song Translation
Can someone please translate the last two stanzas of "Bonito" by Jarabe de Palo? I tried translating it but couldn't and so I tried to find a good translation that looked like a human and not a translator did it, but that didn't work out either. So now I'm stuck. Please help ...
October 31, 2009 by Suchindram

spanish
"Do you know the requirements?" Which translation is appropriate for the above question: 1. Conoces alquien con estos calificacones? 1. Conoces alguien que puede llenar estos requisitos? Thanks! Or am I totally off! Thank you for using the Jiskha Homework Help Forum. Actually...
April 13, 2007 by jules

algerbra
16 less than q, what is the translation?
April 6, 2010 by renee

Alegbra 1a
8 Increased by b The translation is
April 8, 2012 by Dede

algebra
What is the translation of 24 increased by y??
October 26, 2014 by Bobbie

math
Prisilla performs a series of transformations on a figure in the plane. First she dilates it by a factor of 3 and translates it 5 units to the right. Next she reflects it over the x axis, then over the y axis. Finally she reflects it over the line y=x, translate it 5 units to ...
February 9, 2008 by bob

math
translation: 23 less than d is it 23 - d or -23d
September 21, 2009 by Anonymous

biology
what is anterior tibial translation?
July 27, 2012 by Carla

Precalculus
Verify these answers please. 1. Which of the following functions would f(x) = log(base 10)x horizontally 4 units to the left? a) f(x)=log(base10)(x-4) b) f(x)=4Log(base10)X c) f(x)=log(base10) x+4 Answer: C ------------------------------------ 2. State the transformations, in ...
January 29, 2012 by Melinda

biology
The sequence below begins with the initiator methione. ATGTTCAATGTTATGGATTGGCCCTGGTAAATGAAATAGAATGAT Please give a hypothetical (translation of cDNA sequence into single amino acid codes if there is a C deletion in the phenylalanine codon _4pts.(Please give a hypothetical ...
September 24, 2013 by aisha

Spanish
Having some trouble with articles. When would I use 'los/las' and 'unos/unas' Example: Rewrite these sentences changing the words in brackets to the plural. 1. (El es un hombre) de Bariloche Ellos son unos hombre de Bariloche. Would not 'los' sound more correct instead of '...
February 11, 2009 by Larry

english
translation for acts like a hotdog
October 2, 2009 by Anonymous

math
what is a translation over a vertical line?
April 9, 2012 by tiana

Math
Apply a translation up 6 units to the following F(x)- -6x-10
December 10, 2013 by Hannah

Math
Apply a translation up 6 units to the following F(x)- -6x-10
December 10, 2013 by Anonymous

biology
In what part of the cell does translation occur?
April 24, 2014 by Miguel

Algebra 2
Write an equation for the translation of y=5/x that has the asymptotes x=6 and y=7.
May 24, 2014 by Caleb

Algebra 2
what is an equation for each vertical translation of y=2x-1: 3/5 units up f) y=2x-2/5 g) y=2x-1/5 h) y=2x-8/5 I) y=2x+1/5
September 16, 2014 by Alice

Algebra 2
what is an equation for the vertical translation of y=2x-1: 3/5 units up f) y=2x-2/5 g) y=2x-1/5 h) y=2x-8/5 I) y=2x+1/5
September 16, 2014 by Alice

math
Prisilla performs a series of transformations on a figure in the plane. First she dilates it by a factor of 3 and translates it 5 units to the right. Next she reflects it over the x axis, then over the y axis. Finally she reflects it over the line y=x, translate it 5 units to ...
February 9, 2008 by bob

Spanish translation
El maistra es una aficionado el beisbol.
September 25, 2007 by Anonymous

spanish
is there anywhere that i can get a translation of some problem words? <3
October 28, 2007 by chelsea

Polish -> English translation
What does "badz chiho" mean?
May 24, 2008 by Anonymous

Spanish
What is the correct translation for "nickname"? Is it "sobre nombre"? Thank you.
August 11, 2008 by jules

BIOLOGY
Which involves RNA? a. transcription b. replication c. translation d. b and c e. a and c
October 21, 2008 by KJG

geometry
Is there a shape that does not translate or have translation congruencies.
November 5, 2009 by KAYTLYN

Classics
What are some similes in The Odyssey? (lattimore translation)?
July 27, 2010 by S

American Goverment
Which is the correct translation of de jure segregation?
April 14, 2011 by Anonymous

math
If a translation maps point (3, 2) to (4, 5); or T : (3, 2) (4, 5), indicate the image for (2, 4).
July 20, 2011 by robbie

geometry
how do you construct a reflection, rotation, and a translation of a triangle?
November 13, 2011 by Anonymous

Algebra
write a translation rule that maps D(7, -3) onto D' (2,5)
October 18, 2013 by Steve

Quick math help
Apply a translation up 6 units to the following F(x)- -6x-10
December 12, 2013 by Anonymous

math
Describe the following reflections or translation in words 1.(x,y)--->(x,-y) 2.(x,y)-->(-y,-x) 3.(x,y)-->(x 4,y-4)
August 20, 2014 by michael

French Translation needed
I translated some of this but it's not making sense to me. Here it is: On dit qu'il faut etre actif pour apprecier la vie. Etes-vous d'accord? Que veut dire actif pour vous? Illustrez votre opinion avec vos propres experiences ou avec des experiences que vous avez observees ...
December 5, 2006 by cbarnett

Algebra
Write an equation for the translation so the graph has the given vertex. 1. y=-|x| vertex (-5,0) 2. y=2|x| vertex (-4,3) 3. y=-|x| vertex (p,q) I really have no idea how to even begin these, but I do know the answer to # 2 is y=2|x|+11 and #3 is y=-|x-p|+q Thanks in advance. ...
October 5, 2006 by Josie

science
I am looking for my study guide - what ends translation ( genetics)
March 18, 2009 by sam

algebra 1A
translate to an algebraic expression 22 less than y translation is. is this correct b-48=43?
September 17, 2009 by Lea

Algebra 1A
translate to an algebraic expression. 3 divided by y. the translation is =3/x=1 & y=3 is this correct? thanks
September 26, 2009 by Lea

Algebra 1A
translate to an algebraic expression 32 more than n, translation is > is this correct? thanks
September 26, 2009 by Lea

Cell Biology
What do the two steps of transcription followed by translation do?
December 13, 2010 by Lindsay

spanish
what is the english translation of all fill del compare?
March 2, 2012 by vicente

Geometry
What translation rule can be used to describe the result of the composition of (x, y) (x 9, y 2) and (x, y) (x + 1, y 2)
March 16, 2013 by Neely

French
What is the English translation of: Que veut dire VTT?
May 25, 2013 by Erika

algebra
what is the translation of two more than four times the number
September 7, 2013 by yvonne

Math
Apply a reflection and translation down 3 units to the following G(x)=3x-2
December 10, 2013 by Hannah

Math
Apply a reflection and translation down 3 units to the following G(x)=3x-2
December 10, 2013 by Anonymous

Careers
What exactly is a translation career? I know it has something to do with learning many languages.
March 8, 2014 by Anonymous

Geometry
What translation rule can be used to describe the result of the composition of T<-5,-3>(X,Y) and T<-7,-1> (X,Y)? A. T<12,-4>(X,Y) B. T<-12,-4>(X,Y) C. T<2,-2>(X,Y) D. T<-4,-12>(X,Y)
March 27, 2014 by Libby

math
Which is a rule that describes the translation of a point form (4, 8) to (7, 10)? A.(x,y)--->(x+34,y-2) B.(x,y)--->(x+34,y+2) C.(x,y)--->(x-34,y-2) D.(x,y)--->(x-34,y+2) My answer:B
May 31, 2014 by Anonymous

Pages: 1 | 2 | 3 | 4 | 5 | 6 | Next>>

Search
Members