September 1, 2014

Search: Stats- need someone to check

Number of results: 51,051

100 people set up a phone call system so that the initial contact person call three persons, each of whom calla three persons,and so on until all have been contacted. The maximum people who do not need to make calls is? Very Simple Question How would you solve it: (1+x^2)(1-x^...
October 7, 2006 by Monica

Could someone please explain to me how I would read a z table. I have a z score of 2.2 and I need to know what the percentages is. Then if I'm given 8% how do I find the z score?
March 5, 2013 by Bonnie

Hello, can someone help me solve and check the following 1) x - 8 = 20 Check: 2) x + 15 = 35 Check: 3) -x +6 = 3 Check: The symbol 'x' is in italic. If I can understand the symbols better, I belive I can get the hang of the course.
January 8, 2010 by Tamir

Hello, can someone tell me if I got the following solve and check work correct? 1. solve and check 1/2x = 3 5/6 1/2x = 3 5/6 1/2x = 23/6 3x = 23/3 x = 23/3 And to check for it 1/2x = 3 5/6 1/2x = 23/6 46x = 6 x = 6/46 x = 3/23 2. Solve and check 3x + 2 / 2 = 7 3x + 2 / 2 = 7 ...
April 13, 2010 by Tamir

I have no money at all no credit card or checks or anything! So can someone please tell me where to get a free background check or free record check?? I really need this please!!
February 14, 2011 by NEEDS HELP!!

Can someone help me with mechanics. I need to check my answers
January 31, 2014 by Anonymous

Of 43 bank customers depositing a check, 18 received some cash back. (a) Construct a 90 percent confidence interval for the proportion of all depositors who ask for cash back. (b) Check the normality assumption.
April 18, 2014 by Kevin

Math 157
Can someone please help me. At a quality control checkpoint on a manafacturing assembly line, 10% of the items failed check A, 12% failed check B, and 3% failed both checks A and B. a. If a product failed check A, what is the probability that it also failed check B? b. If a ...
December 8, 2010 by Rena

English and grammar
i need someone to check my work but i cant just copy it and paste it here. i need to send it via e-mail. please give me your email add and ill send it to you. thanks
November 25, 2012 by john

Can someone please help me. At a quality control checkpoint on a manafacturing assembly line, 10% of the items failed check A, 12% failed check B, and 3% failed both checks A and B. a. If a product failed check A, what is the probability that it also failed check B? b. If a ...
December 8, 2010 by Rena

I Need Someone to check my essay for me and give me some input please.
January 12, 2013 by STACY

Of the two fractions 15/21 and 19/17 which is smaller? I think its 19/17 but need someone to double check please.
May 30, 2012 by tony

Could someone check this for me please? The equation is 2/x+3 = 4/x+7, and I think the answer is x=1, I just need help showing the steps of how to get there if anyone knows? Many thanks for any help
May 5, 2010 by Dereck

is there a good, relevant sites where i can get stats extra help?
October 11, 2007 by Keirson

Use this z-score formula for this problem: z = (x - mean)/(sd/√n) x = 1.25, 1.50 mean = 1.35 sd = 0.25 n = 40 Calculate two z-scores, then use a z-table to determine probability between the two scores. I hope this will help get you started. •stats. - Christina, Monday, ...
March 18, 2013 by Christina Ms Sue please help

Stats- need someone to check
Doing this assignment and was wondering if i got the right answers According to the Census Bureau publication Current Population Reports, the probability distribution for household size (number of people per household, say X) in the United States is as follows. For the ...
February 7, 2011 by Ryan

I need someone to check my answer, can someone please help me? Here is the problem: Business and finance. In a bottling company, a machine can fill a 2-liter (L)bottle in 0.5 second (s) and move the next bottle into place in 0.1 s. How many2-L bottles can be filled by the ...
August 3, 2009 by Anonymous

"Find the slope of the line passing through J(0,5) and K(-1,2)" I did the problem but I just need someone to check if its right. my work: M= y2 - y1 -------- x2 - y1 M= 2 - 5 ----- -1 - 0 M= -3 ---- -1 M= 3 Thank you.
March 4, 2014 by Kylee

i was wondering if someone could check the answer i got for this math problem 7+2(5-2*9) = 243 I got -19 I think you're supposed to do the parentheses first...but within that, you're supposed to do the multiplication and THEN the subtraction, and then mult it by 2....then add ...
July 20, 2007 by Anonymous

Scientists wish to test the mind-readiing ability of a person who claims to have ESP. They use five cards with different and distinctive symbols( square, cicrle, triangle, line, squiggle). Someone picks a card at random and thinks about the symbol. The mind-reader must ...
October 17, 2011 by JONATHAN

I need to do a project for ap stats. It can be anything im interested in, and i have to perform some tests and all that I need some ideas!! Somthing that would be interesting..
May 28, 2008 by MJ

rounding numbers
I need to to round 423,607,492 to the ten thousands. I then need to round it to the million. Can someone help me. I will be happy to check your work. Which numeral is in the ten-thousand place in this number? Which numeral is in the million place? Once you have those ...
April 18, 2007 by Don

Algebra II repost- please check
I posted these a little while ago but this time I have answered them. 1. Does the graph of y = x – 3x2 + 5 have a maximum or minimum? 2. What is the vertex of the graph of y = -2(x - 3)2 + 4? 3. Does the graph of y = -2(x - 3)2+ 4 open up or down? My answers: 1. I cannot ...
November 27, 2007 by JaneLee

I need someone to check this
Add and Simplify: 100x/x+10 + x^3/x+10 I have the answer as X^3+100x/X+10 is this correct?
October 12, 2008 by Jennifer

Can someone please check my answers below for accurateness? The instructions are: Differentiate and simplify. 1) y=(2x^2+3x-1)(3x^2-5x-3) y'=(4x+3)(3x^2-5x-3)+(2x^2+3x-1)(6x-5) 2) y=(5x^2+3x-1)(3x^2-5x-3) y'=(10x+3)(4x^2-3)+(5x^2+3x-1)(8x) 3)y=6x^3-7x^2+5x-7+x^(5/3)-7/(x^3) y...
August 7, 2009 by Christine

Can someone help me with mechanics. I need to check my answers
January 31, 2014 by Anonymous

C++ Programming
Design and create a class named Stats that has an array of 12 doubles as one of its member variables. The values in the array should be set by making 12 calls to a public member function named setValue that accepts two arguments, an integer indicating which value is being ...
June 8, 2010 by kyuu09

please please someone check my work I don't understand it fully so I am asking if someone could please check my work thank you if it's too much I'm sorry. God Bless
January 21, 2009 by Hellokitty1993

using a calculator need p value on a r tailed test if the n=9 and the t is 3.204
December 2, 2011 by James

Need help finding the area under the normal curve between z = -1.0 and z = -2.0?
April 16, 2014 by Betty

Could someone check my answer? I need to figure out the equation of the circle given the center of (-9,0) and radius of 7. (x-(-9))^2 + (y-0)^2 = 7^2 answer(x+9)^2 + (y-0)^2 = 49 is this correct?
September 20, 2009 by sam

Human Disease
I am really stuck and am in need of websites or someone to point me in the right direction. I am doing a research paper and need to know what body systems may be affected by obesity? Can someone help me please?
September 11, 2008 by Anonymous

Think I know the answer, but can someone please confirm... Find the value of a that corresponds to a confidence level of 84%. Answer: 0.16???
September 13, 2008 by Cassy

Polynomials check my answer
My brother said I did this wrong can someone check this for me please X Y-1 = sum(x)+ (y-1)=(X+y-1) diff(x)-(y-1)=(x+y+1) Product (x) (x-1) = (xy-1) = (xy-1)
September 19, 2013 by tela

I need someone to check and go over my answers to make sure they are correct and if not could you go over them with my on why and how to solve correctly?? Thank you much appreciated.. Add. -4/5 + (9/20) = 5/25 1 + (-2) + 3 + (-4) = 10 5/3 + (-4/3) + 5/3 = 6/3
September 1, 2009 by Anonymous

I need someone to check and go over my answers to make sure they are correct and if not could you go over them with my on why and how to solve correctly?? Thank you much appreciated.. Add. -4/5 + (9/20) = 5/25 1 + (-2) + 3 + (-4) = 10 5/3 + (-4/3) + 5/3 = 6/3
September 1, 2009 by Anonymous

I NEED SOMEONE TO CHECK THESE PLEASE!!! IF B IS REPLACED WITH A NUMBER THAT SHOWS THE RELATIONSHIP INDICATED IN THE TABLE, ARE THESE ANSWERS CORRECT? Y = -X + B X Y 1 0 2 -1 8 -7 10 ? 20 ? 40 ? SO, y=-1+1=0....y=-2+1=-1.......y=-8+1=-7........y=-10+-3=-13...y=-20+1=19.....y=-...
September 11, 2009 by ggift

PLEASE HELP Could someone check my answer? I need to figure out the equation of the circle given the center of (-9,0) and radius of 7. (x-(-9))^2 + (y-0)^2 = 7^2 answer(x+9)^2 + y^2 = 49 is this correct?
September 20, 2009 by sam

What data and stats do you need to know in order to identify profitable nations in which to export.
October 5, 2012 by Lisa

Spanish Preterite Check!!!!
Could someone tell me if these are the only things that I need to know for the Preterite? - the time expressions -the ar and er/ir endings -the car,gar,zar endings for the yo form - no written accents: ir,ser,ver,dar are there any other irregular endings? I think what I wrote ...
May 26, 2010 by Amy~

Hi, I need someone to double check my answer because it doesn't seem right to me. Find the centroid of the region bounded by y=0 and y = x^2 -2x. I calculated the area to be 4/3 and centroid (1, 0.4)... is that correct? Thanks in advance!
April 18, 2011 by Monica

Algebra Can someone who is serious respond
Can someone check my answer please? Find the corresponding y values for x= -2,-1,0,1,2,3 if y= x^-x-2. My answers are under Y. X Y -2 -4 -1 -2 0 -2 1 0 2 4 3 10
November 20, 2007 by Alicia

career aw
Can someone plz get a website all about photography for me I really need it for a project that is due tomorrow that my teacher assigned but i need a little bit more about what their daily tasks are?!?!?!?!?!?!? I REALLY NEED HELP!!!!! PLZ SOMEONE!!! THANXS
September 25, 2007 by Stacy

I need someone who know a little bit of Spanish. I am having trouble learning the jugar verbs. I need someone who knows them and is willing to teach me. Thanks, Taylor
March 5, 2008 by Taylor

Alg 2
Ok heres another factoring that I need someone to check Problem: -x^3 + 27 -(x^3 - 3^3) So I moved the positive and found out what cubed would make 27 Using the forumla: (a-b)(a^2+ab+b^2) -(x-3) (x^2 + 3x + 9) Right? Or did I make a mistake?
January 7, 2009 by Chopsticks

Ok heres another factoring that I need someone to check Problem: -x^3 + 27 -(x^3 - 3^3) So I moved the positive and found out what cubed would make 27 Using the forumla: (a-b)(a^2+ab+b^2) -(x-3) (x^2 + 3x + 9) Right? Or did I make a mistake?
January 7, 2009 by Chopsticks

A check returned by a bank because the issuer's cash account balance could not cover the check is called a(n): a. Cancelled check b. Certified check c. Outstanding check d. NSF check
October 18, 2012 by Anton

Five chips numbered 1-5 are placed in a jar. Two chips are drawn. Let Z= the sum of the numbers. WHat is the expected value of the random variable? I know I have to use E = np Can someone explain?
May 26, 2009 by MW

Math check my answers
I posted this before can someone please check my answers and help me thanks:) 2 rectangles have equal areas determine the area of each rectangle then use this info to determine the perimeter. rectangle one: length of 2p + 3 width of 3.8 after my work i got p= 1.5 so the area ...
June 2, 2013 by Rihanna

previous post
has anyone read my 4 previous posts? I really need someone to check my answers. Please be patient, Erin. Our advanced math teachers are not online right now, it seems. =)
July 28, 2007 by erin

i need someone's help What do you need help with? Please put your question on the board and someone will be more than please to help. thanks for asking Jiskha.
October 28, 2006 by chandani

so i have this 5-3 gene sequence and i need to transcribe it to a polypeptide and im not sure my trascription is right could someone check gene sequence(ACCTGATGGCCGTTAATCTATTTAAGGCCTGAAGTAACGTATGG) trans(ThrTrpProLeuIleTyrLeuArgProGluValThrTyr)
August 5, 2014 by bio

adult education
I need help with someone to go over my eassy with me can someone please help me.This is my first time using this site so I don't know how it really works SOMEONE PLEASE HELP ME!!
October 27, 2010 by jennifer

early childhood in language arts
to be an effective worker in an inclusive early childhood classroom, you: A. Need a great deal of special training B. Must have prior experience in a pediatric care environment C. Need to think of exceptional children as different D. Will need to collaborate with other ...
September 6, 2011 by Vanessa

Can someone please explain how to find the frequency from: Lower limit:230,240,250 upper limit:239,249,259 Mid Value:234.5,244.5,254.5
September 3, 2012 by Alexander

Asap can someone pplz check these answers
Please check my answers I have 2 do other things right now
January 26, 2009 by Remy

History of health care
Please check my answer thanks :) If you need to talk to someone about getting additional coverage to Medicare Parts A and B what organization should you contact ? I am not to sure is it Blue cross and Blue Shield
February 19, 2008 by Ashyleah

Can someone please check this sentence. I want to make sure I DONT need a comma in the sentence. THANKS! I have found her to be extremely competent in areas by exemplifying her creativeness through many challenges she has taken upon herself.
March 3, 2011 by april

Could someone please explain this problem to me. I need to factor and check by multiplying. 7x^9y^7+35x^7y^6+35xy= Here is what I got but I don't think that it is right. 7x^9y^7+35x^7y^6+35xy= 7xy(x^8y^6+5x^6y^5+5) Is this correct? Thanks.
April 26, 2010 by B.B.

About 35% of the population has blue eyes (based on a study at Indiana University). a. If someone is randomly selected, what is the probability that he or she does not have blue eyes?
November 14, 2012 by Yolanda

math-please check my answer
0.6x + 4 < 1.0x - 1 6x + 40 < 10x - 10 4x > 50 x > 12.5 can someone please check my work and tell me if I am right?
July 30, 2010 by Michelle

1. You need to check the time. (What kinds of time should be checked acording to the sentence? Does ' check the time' have a lot of meaning according to the context? Does it also mean "Check what time it is now.?"
September 9, 2010 by rfvv

If you earn the grades of 81, 84, 78, 80 in four tests what should your final test’s score be in order to have an average of 81%? .81x400=324 Need a total of 324 pts Test grades so far 81,84,78,80 = 323 324-323=1 You need at least one more point to get an 81 Can someone please...
September 10, 2009 by Kay

7th grade
You need to give examples for someone else if they would need help on controlled experiments which includes pictures that you give and someone tells if it is a controlled experiment or what the variable is
September 15, 2008 by Danielle

Angela is conducting a poll on campus to determine the next student representative. How many students does she need to sample for a confidence level of 90% with a margin of error of + or - 5%?
May 14, 2011 by Ana

I need to find the second derivative of y=x(x-1)^1/2. I found the first derivative is 2x-1/2(x-1)^1/2, if someone could check, but I am miserably stuck on the second derivative.
April 18, 2011 by Amie

A basketball player, standing near the basket to grab a rebound, jumps 73.6 cm vertically. How much time does the player spend in the bottom 15.4 cm of the jump? Ok...after this I swear I'm done! I just need someone to check my final answer, which is 0.0858 s.
October 10, 2007 by Lindsay

I need someone to please check my answer for me... add. -1.6 + (-2.3)= the answer I got was -3.9 is this correct? if not could you tell me why and how to get the correct answer..? thank you
September 1, 2009 by Anonymous

can you please check my answers to the questions i realy need to check them if they right or wrong
February 15, 2012 by sososola2012

Urgent Math please check
Very Important I can get someone to check these for me... I have to get an A, and I was wondering if someone could double check these for me. I am about 95% sure they are right, but just need a fresh set of eyes. I know I've been sending alot, but I really need them to be ...
April 2, 2011 by Brittany

Thank you very much. I still need you to check a few urgent things, Writeacher. 1)The line is engaged. Would you hold? Would you like to hold the line? Would you like to hang on/hold on? Which are possible? 2)You needn't have bought the milk; there was some already/there was ...
May 20, 2012 by John

For someone to struggle for freedom (any sorts of freedom), do you need to be committed? And if you do, what are some ideas how being committed is helpful to attempt to gain freedom? I thought of one point, I know you need to be committed to gain freedom because you need to ...
November 24, 2007 by Anonymous

For each of the following measurements state the number of significant digits: A length of 2.3 meters A volume of 0.65 liters A time of 0.0004 secs A population of 65,000,000 A distance of 1.30 x 104 I got: 1. 2 2. 2 3. 1 4. 2 5. 2 Just need someone to check my answers please ...
November 30, 2013 by Katie

Grammar and Composition
please check these: Divide each of the following words into its prefix, root, and suffix. some words may not have a prefix or a suffix. WORD misused subscribe distorted regression deported interruption prefix dissection postscript implacable PREFIX mis sub dis re de ? pre ? ...
October 14, 2009 by y912f

Stats help!
Does anyone know how to find the variance or something if only the correlation of something is given and the other way around?? I really need help with this! THANK YOU!
April 6, 2009 by ash

I need a paragraph telling about myself but i need someone to check it for me. Bonjour mis amis. Je m'applle lisa. Je suis vingt ans. Mon couleur preferee est le bleu. Mon saison preferee est l'automne. Je suis drole, actif, et intelligent. J'ai un appartment a New York. Je ...
November 20, 2010 by lis

bus. stats
Given that math SAT scores are normally distributed (follow the empirical rule) m=500 Standard deviation=100 what is the math SAT score for someone who is in the 80th percentile of his or her class.
March 3, 2010 by mike

bus. stats
Given that math SAT scores are normally distributed (follow the empirical rule) m=500 Standard deviation=100 what is the math SAT score for someone who is in the 80th percentile of his or her class.
March 3, 2010 by mike

Chemistry URGENT
I need someone to check to make sure that I balanced my equations correctly. I have to add a (g) or (s) to indicate gases and precipitates. I am having a hard time figuring out the ions and how to add them, if any of these reactions need a ion could you explain it to me as ...
April 24, 2014 by jazz

Can someone check my work? English: My cousin came over to play. We were running around the living room. My brother and cousin crashed into each other. And my brother cut the corner of his eye open. Spanish: Mi primo vino a casa jugar. Fuimos correr alrededer de la sala. Mi ...
October 7, 2009 by Larry

What are the odds against getting three heads in three successive flips of a coin? Odds against A = (1 – 3/6)/ (3/6)= 3/5 = 3::5 Could someone check my answer and correct me if I need it please
November 28, 2009 by Punkie

Chem I just need someone to check my answer
arrange the following compounds in the order of increasing polarity HF, H2SE, N2, H2s I believe that the answer is H2Se < H2S < N2 < HF Is that correct?
February 13, 2011 by Kathy R

Algebra 2 - stats and probability
I need someone to tell me how to set these up please? 1. A box contains 4 quarters. 2 of the quarters have the American eagle on the back. Suppose you draw 2 quarters at random with replacement. a. What's the probability that both have the American eagle on the back? b. What's...
May 13, 2009 by Kay

could someone check these answer please? solve the following proportion for x. x/8=5/3=0 rueben drove 300 miles using 14 gallons of gas, at this rate, how many gallons would he need to drive 210?= 40.3 gallons solve for v; v^2+v-30=0=v=-6,5 thanks
October 31, 2010 by lee

Health care
Please check my answer thanks :) You need to speak to someone about additional coverage to Medicare Parts A and B Blue Cross and Blue Shield would be the best organization to contact. True or False I picked True
February 23, 2008 by Michalea

Can someone please check my answers? Which of the following settings are evident in Unit 4's stories of Twain, Jewett, and Chesnutt? Check all that apply. American West* pos-Civil War South* New England* Gold Coast
January 17, 2014 by Cassidy

stats ( please check)
6. X has a normal distribution with a mean of 80.0 and a standard deviation of 3.5. Find the following probabilities: (A) P(x < 77.0) (B) P(75.0 < x < 85.0) (C) P(x > 85.0) (Points : 6) I think I have the first two but I am stumped on the third one. Thank you for ...
July 24, 2011 by Celest

Pre-Calc-Please check my answer-I think I have it
Could someone please check these-I had tried one last night but it was really wrong so I'm been working-hopefully these are correct. What are the roots of the equation and answers have to be simplified 2x^2 + 5x-10 =0 2x^2 + 5x-10+10=0+10 2x^2 + 5x = 10 2x^2 + 5x/2 = 10/2 2x^2...
September 7, 2011 by Sheila

Pre-Calc-Please check my answer-I think I have it
Could someone please check these-I had tried one last night but it was really wrong so I'm been working-hopefully these are correct. What are the roots of the equation and answers have to be simplified 2x^2 + 5x-10 =0 2x^2 + 5x-10+10=0+10 2x^2 + 5x = 10 2x^2 + 5x/2 = 10/2 2x^2...
September 7, 2011 by Sheila

Spanish-Check please! I need help
Please check-I'm having a problem interpreting these questions and I have to answer them for homework. Could you please check my translation I'm not sure what these questions mean and I have to answer them for homework ¿Qué necesitas para comer en cereal?does this ask what I ...
March 21, 2012 by Ellen

Stats 330- HELP
I need some help on this question it has two parts but i can't figure it out. Can someone help me. The NDSU library checks out an average of 320 books per day, with a standard deviation of 75 books. Suppose a simple random sample of 30 days is selected for observation. What is...
March 10, 2011 by John

i need someone to explain to me how i got this answer...i know the answer but i need an explanation to the problem... C=2pi(r) the answer is r=C/2pi...i need someone to explain it to me..thank you C = 2pi(r) Divide both sides by 2pi C/2pi = r ----> r = C/2pi ...
August 16, 2007 by logan

how to write a check
this is my second time writing a check, and I know how, but How do i write $1,464.00 in words on a check. Is it "one thousand four hundred sixty four dollars" Is it hundred or hundreds? Do I need to say something about the zero cents?
May 19, 2008 by jen

Chemistry conversions check
I'm sooooooo not sure if I'm doing this right, but can someone check it please? Thanks :)) 5) Determine the mass in grams of 3.01 x 10^23 atoms of Cl (element) I got 17.5 this right?
September 10, 2009 by Emily

Ok, I figured this out (I think) but can you please check? Don't worry. I can carry the tent all by myself because it is so light. I do not even need a lantern it is so light outside. In these sentences, the word "light" is used as a: A:homophone B:homonyme C:synonym D:simile ...
April 15, 2011 by Catherine

Genetics (plz check answer)
Question: Calculate the frequency of the AA, Aa, and aa genotypes after one generation if the initial population consists of 0.2 AA, 0.6 Aa, and 0.2 aa. What I have done is: P = (0.2)+(0.5)(0.6)= 0.50 q = 1-p = 1 - 0.50 = 0.50 Can someone check my answer plz.
December 6, 2006 by Josh

bio (plz check answer)
Question: Calculate the frequency of the AA, Aa, and aa genotypes after one generation if the initial population consists of 0.2 AA, 0.6 Aa, and 0.2 aa. What I have done is: P = (0.2)+(0.5)(0.6)= 0.50 q = 1-p = 1 - 0.50 = 0.50 Can someone check my answer plz.
December 7, 2006 by Josh

computers (Check)
Will someone please check my C++ for me? 1. What does the Load ( ) method do? Gets data from a file and puts it into a DataSet object. <----- Gives a value to an attribute of an XmlElement object. Deletes all the data in a DataSet object. Tells a form to appear. 2. Scenario...
May 30, 2013 by Lisa

Alg 2
Can someone tell me how to factor 2a^2 - 16ab + 32b I just need someone to help me get started, and I want to see if I can finish it.
January 7, 2009 by Chopsticks

physical fitness or sports
Name 10 career options in the fields of physial fitness or sport. I have come of with these: -physical trainer -player -coach -refree I need help. Can someone help me to come up with the other 6. And also please check if I am corect. Thanks for help!!!
January 19, 2009 by jess

Pages: 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | Next>>
