October 8, 2015

Search: Genetics

Number of results: 347

Criminal Justice
Discuss the merits of the idea that genetics are a source for criminal behavior. Make sure to provide examples that can be found through research studies and have evidence linking genetics and crime, including twin studies, adoption studies, and testosterone studies. What are ...
September 8, 2013 by Danita

A homozygous pea plant with round peas and yellow cotyledons was crossed to a wrinkled, green plant. The F1 was selfed and produced: 193 round, yellow 69 round, green 64 wrinkled, yellow 26 wrinkled, green a) propose hypothesis that allows you to calculate expected values ...
September 2, 2011 by Tommy

What is Genetics?
February 23, 2015 by Hossain

need help with these genetics problems. please help with what you can. thanks: Given that loci A and B in Drosophila are sex-linked and 20 map units apart, what phenotypic frequencies would you expect in male and female offspring resulting from the following crosses? (Assume A...
September 24, 2007 by stew

Whats a homolog?
November 3, 2008 by Lena

How are the structures in genetics related?
October 5, 2010 by Jack

why are karyotypes important tools for genetics?
May 12, 2009 by Anonymous

Biology 101
How are meiosis and genetics related?
October 25, 2010 by Anita fields

CAN SOMEONE REVIEW MY ANSWERS AND TELL ME IF THIS IS CORRECT? Why is it flawed to ask how much of a particular behavior is due to genetics and how much is due to experience? It is inconsistent to think that behaviors are solely due to our genetic make-up. When it comes to our ...
January 30, 2009 by SinnerSaved

Science, Genetics
Please help me with science genetics questions? Thanks to all who answer. :) 1. Chromosome pairs contain different versions of genes, which are called ________. 2. The process in which body cells are duplicated in order to grow and repair body tissues is called _____________. ...
March 10, 2014 by Hannah

What is a result of scientific research in the field of genetics
March 19, 2010 by Melanie

Why is DNA replication termed semi conservative?
December 1, 2014 by Tina

Are an organism's characteristics determined only by its genes? Explain. Yes, an organism's characteristics are determined only by It's genes becuase the parents give their offspring genes which determines their characteristics. Is my answer correct? Do I need to expand on ...
February 25, 2007 by franny

I am looking for my study guide - what ends translation ( genetics)
March 18, 2009 by sam

6th grade genetics
transferring a gene from one organism to another
May 26, 2009 by kay

how does the urinary system support reproduction and passing on genetics?
June 27, 2009 by Liz

Can chromosome instability cause an individual to be highly susceptible to cancer?
October 3, 2009 by Sarah

Can you help me determine the phenotype and proportions expected from these crosses in chickens? a) RR Pp x rr Pp b) rr PP x Rr Pp c) Rr Pp x Rr pp
September 9, 2011 by Tommy

early childhood
evolutionary psychology and behavior genetics: watson
February 23, 2012 by jen

biology - genetics
is the cis-regulatory sequence found in the exome?
March 26, 2014 by santoki

Please Help Me :( Science: Biology, Genetics!
Please help me with science genetics questions? Thanks to all who answer!! :) 1. Chromosome pairs contain different versions of genes, which are called ________. 2. The process in which body cells are duplicated in order to grow and repair body tissues is called _____________...
March 10, 2014 by Hannah

what is the chance of a woman having five female children in a row?
January 9, 2008 by Matthew

human Genetics
In a mouse cell at the start of mitosis, how many chromatids are present?
September 15, 2011 by kay

In general, what two methods are used to grow bacteria in the laboratory?
February 8, 2012 by Anon

if there are two forms of each of the seven traits, how many possible combinations are there?
May 23, 2012 by JEN

Biology - genetics
How does crossing over change the combination of alleles in gametes? Thanks :)
August 23, 2012 by Cally

What kinds of amino acids on histone tails are able to be phosphorylated and why?
October 14, 2012 by ren

why are there not many clinical studies done on rare diseases such as Batten disease?
April 13, 2015 by sheri

What would happen during DNA replication if there were no thymine nucleotides available?
October 28, 2009 by sam

7th grade science
Why was Gregor Mendel given the title "The Father Of Genetics" ?
December 13, 2009 by mary

The following DNA segment has one ORF. Do you know what it codes for? 5'-TAGGATGTTCGACATGTAAGCTT ATCCTACAAGCTGTACATTCGAA
November 10, 2011 by Tony

Biology -Genetics
True or False X and Y chromosomes are found only in eggs and sperm. T or F ?
March 5, 2014 by Amy

quick science question
What are some ways in which genetics collect samples to test for disorders?
August 28, 2009 by Lauren

7th grade science
name two scientest who studied inherited genetics and what they used for research and why
November 17, 2009 by alice

Biology 101
Summarize the inheritance of sex-linked traits through meiosis and how it relates to genetics.
October 25, 2010 by Anita fields

Biology 101
Summarize the inheritance of sex-linked traits through meiosis and how it relates to genetics.
October 26, 2010 by Anita fields

What is an approximate value of the length of a 30 nm fiber that contains 120,000 nucleotide pairs of DNA?
October 31, 2011 by Kyle

bio : fundamentals of genetics
A 3:1 ratio of tall to short plants in the F2 generation lends support to the principle of ________________.
June 1, 2008 by Henry

In reference to plant and animal adaptations, how are the principles of heredity and genetics applicable to how organisms change over time?
August 12, 2011 by Anonymous

GBE (Genetics)
What are the advatages of Eukaryotic genes splitting up? I'm not so sure how to approach the question, is it something to do with exons & introns or the nucleotide sequences?
October 7, 2008 by Claire

If you had to argue that either genetics (nature) or environment (nurture) has the greater impact on human development, which would you pick and why?
March 1, 2011 by Rica

law ans ethics in allied health
the science of improving hededitary is known as a.genetics b.amniocentesis c.dna research d.eugenics my answer is a
November 10, 2013 by susue

Biology - Genetics
If genes a, b, c, and d are genetically linked to each other, does it follow that a recombination experiment would detect genetic linkage between a and d?
February 11, 2015 by Mel

Are there any websites that explain Mendelian genetics and show how to solve such problems in an easy, concise manner at an AP Bio level? Thank you
March 18, 2015 by Jason

humanistic therapy acknowledge unconscious forces and --- as a source of personal difficulties environment negative thoughts genetics psychosis please help
April 16, 2012 by kevin

1. How is sex expressed at the chromosomal, gonadal, phenotypic, and gender identity levels? How do genes in the pseudoautosomal region of the Y chromosome differ from X-Y homologs?
January 14, 2015 by shala hampton

which do you think was the more far-reaching accomplishment, determining the structure of dna, or sequencing the human genome? state a reason for your answer
February 8, 2015 by Shala

With PCR, one gene is all that is necessary to create a useful genetic fingerprint to discriminate between individuals. True False
March 22, 2015 by Lucy

Question: Calculate the frequency of the AA, Aa, and aa genotypes after one generation if the initial population consists of 0.2 AA, 0.6 Aa, and 0.2 aa. What I have done is: P = (0.2)+(0.5)(0.6)= 0.50 q = 1-p = 1 - 0.50 = 0.50 Can someone check my answer plz.
December 6, 2006 by Josh

studying genetics in mammals where can i find out about felines and canines that are proven mainly allergen free, thought not genetically modified?
September 22, 2009 by elizabeth

The lifespan of plants varies depending on genetics and survival strategies. Discuss the adaptive value of annual, biennial, and perennial life spans.
January 26, 2011 by NEEDS HELP!!

Given the gene sequence ABCDE, crossing over should occur most frequently between_____. a. A-B b.) B-C c.) A-E d.) A-D e.) A-C PLEASE explain how you got the answer thanks!
October 26, 2013 by nini

Suppose that for an organism, 2N = 8. How many chromosomes do the organism's gametes contain? Would it be 8?
February 25, 2007 by franny

How does the circulatory system and the lymphatic system support reproduction and passing along genetics?
June 27, 2009 by Liz

Once the _______ checkpoint is passed in the cell cycles, the cell is committed to division
May 14, 2013 by Anonymous

if a start codon changes into a stop codon, how would this effect transcription? please help.
September 24, 2007 by Sara

science (Genetics and Evolution)
What contains DNA? Where is DNA found? What is the difference between phenotype and genotype?
May 3, 2011 by jason

Wild type, or wt, refers to the genotype that is the typical genotype found in nature. True False
March 22, 2015 by Lucy

What is the difference between genetic inheritance and epigenetic inheritance?
September 9, 2011 by Tommy

1) Do you know if the nucleotide sequence of a mutation tell you anything about its dominance or recessiveness? 2) Do you know the role that Ras play in the signal transduction pathway that makes it an oncogene?
November 4, 2011 by Bobby

Hi, Is it possible to have a recombination frequency greater than 50%? the answer would be yes as they would assort indepnedyt? correct? thanks
December 7, 2008 by Sandy

Genetics 160
Using D for tall plants and d for dwarf plants, a 1:1 ratio is obtained in which of the following crosses? These are my choices: Dd X dd DD X dd DD X Dd DD X DD Dd X Dd
September 29, 2013 by Julie

Bio- Genetics Quest.
A freind of yours brings up the idea that, if a person's gene were all identified and sequenced, he would be able to tell everything about that person: what they look like, how they might act, even how they will progess in life, and how long they would likely live. Is this ...
April 22, 2007 by Richard

Name the term used to describe the phenomenon in which a bacteriophage genome incorporates its genome into the chromosome of the host.
February 8, 2012 by Anon

Can anyone help me with Genetics? I have some problems and answers and need them explained to me. Here are some of the questions and answers: 1. Assume that a dihybrid cross is made in which the genes' loci are autosomal, independantly assorting, and incompletely dominant. How...
September 8, 2007 by frank

Child psychology
Studies on the development of sexual orientation highlight the importance of A.genetics B. environment C. prenatal hormones D. multiple factors I said A the enviroment, Now thinking its D
August 26, 2010 by Anonymous 2

The genome of Elradicus hypotheticus consists of 3 x 105 bp of B-DNA. a. How many turns are present in the double-helix? b. What is the length of the DNA in μm?
March 22, 2015 by Yasmin

Genetics/Di hybrid Cross
Can someone show me how to set up this dihybrid cross? The genotypes of the two parents are RRLL' x RWL'L'. The " ' " meaning "prime."
January 18, 2010 by Anonymous

1.Identify a typical developmental milestone for a person at a specific stage and explain how achievement of this milestone might be impacted by genetics and environment.
May 26, 2012 by Anonymous

If a green eyes girl whose father is green eyeid marries a brown eye boy then what genotype the nxt generTION has
April 21, 2015 by jazz

If a green eyes girl whose father is green eyeid marries a brown eye boy then what genotype the nxt generTION has
April 21, 2015 by jazz

What are three sources of emobroyonic stem cells and how are they obtained from each? This is what I have so far: 1. Blasocyst of an embyro 2. Embilical cord of a baby 3. ? I don't understand how to explain how to obtain them. Don't you just remove them?
November 3, 2008 by Lena

School advice please
What medical research field is in more demand? If I want to get a masters, what would you recommend me taking in undergrad between physiology, biochemistry, genetics, neuroscience or biotechnology?
July 21, 2009 by Alex

i have a diploid cell with 3 pairs of homologous chromosomes A1,A2,B1,B2,C1,C2 with no crossing over. will my daughter cells after mitosis just be [A1,B1,C1] and [A2,B2,C2] or will there be a mix between the 1's and 2's creating more varieties?
September 27, 2013 by Anonymous

A 50 year old male who is not overweight and has normal blood cholesterol levels suffers a heart attack. Propose a possible explanation i think the answer would be genetics...
October 1, 2014 by Sam

______________ means that neither gene in a gene pair (genotype) masks the other. As a result, the traits carried by the 2 genes appear to be blended.
October 13, 2008 by sara

starting with 1000 copies of a template, 35 cycles of PCR were performed. What is the theoretical yield of copies of double stranded product of this amplification reaction?
November 27, 2012 by Josh G.

Phenylketonuria is a metabolic disease of humans that results from an autosomal recessive gene. If the frequency of phenylketonurics in the population is 9/10,000, what is the probability that two normal individuals will produce a diseased child?
November 13, 2008 by Keira

July 11, 2010 by fred

child psychology
The ability to solve abstact problems such as those found in algebra and higher mathematics is influenced by devdlopment and A. genetics B. societal factors C. health D. cognitive style
August 25, 2010 by Anonymous

Describe the inheritance and expression of cystic fibrosis, Tay-Sachs disease and sickle-cell anemia. I didn't understand what the question meant by "expression." Please help!
February 24, 2008 by Anonymous

intro to psychology
Genetics and what we inherit from our biological parents play a significant role in our intelligence level. In fact, researchers have found that:
June 24, 2015 by elly

Science (Genetics)
How many males in America have brown eyes, green eyes, and/or blue eyes?
October 14, 2008 by Mariz

I have a quiz on genetics on friday in AP Biology and I would like some sites with good ap biology questions on them. I don't know any of them which I could go to.
December 3, 2008 by Roger

how does the existence of cells, organelles, cellular reproduction, natural selection, DNA replication, transcription, translation, heredity, genetics, mutations, and taxonomy provide evidence that supports the theory of evolution?
June 15, 2008 by Aneesah

How is personality developed? What roles do genetics and environment play in personality development? How do experiences influence personality? How is a person motivated?
April 27, 2010 by Mike

population genetics
In a population where 8% of the men are red-green colour blind, what are the expected proportions of genotypes for the males and females? (Assume the trait does not affect survival or fertility.)
November 13, 2008 by lianne

Recombination frequencies a. arise from completely random genetic exchange. b. are the same for all genes. c. decrease with distance. d. are the same for cis and trans heterozygotes.
March 18, 2010 by Sonya

DNA markers, or variant non-coding regions of DNA, are DNA polymorphisms that are useful for genetic mapping. True False
March 22, 2015 by Lucy

identify major factors that influence fitness potential. Thanks!! roy/cindy genetics, health, age, are some that come to mind. Do you not have a class text book?
November 14, 2006 by roy

Consider the cross AaBbCcddEe X AABBccDDEe. If these 5 allele pairs all assort independently, then the probability that any individual offspring will have the genotype AaBBCcDdEE is 1 out of???
October 31, 2014 by Pre-med student

given the following genotypes GgWwTt and GgWWtt. what is the probability of producing an offspring with the following genotype? How do i solve this problem?
November 5, 2010 by lou

In E. coli, replication begins at which chromosome site? A.The replication fork B.Hfr C.oriC D.TATA box E.Pribnow box
March 22, 2015 by Lucy

explain the importance of making proteins fluoresce. Explain the importance of animal studies on GAN.
April 12, 2015 by Shala

evolutionary psychology and behavior genetics a. have little in common b. acknoweledge the interactions of heredity and evirronment c. focus on lerning and experience d. are two schools of thought first introduced by john b. watson
August 1, 2013 by meka

A male with singed bristles (sn) appeared in a culture of Drosophila. How would you determine if this unusual phenotype was due to an X-linked mutation? Can you show the crosses that you would do to determine this?
September 9, 2011 by Tommy

I am having trouble wording this question. Describe the differences in the outcomes for a dihybrid cross ifgenes are: a. completely linked b. completely unlinked c. incompletely linked.
April 15, 2012 by Lucylu

Evolutionary psychology and behavior genetics: A have little in common B acknowledge the interaction of heredity and environment C focus on learning and experience D are two schools of thought first introduced by John B.Watson, Is B maybe correct?
September 16, 2009 by 888

Chemical analysis of the DNA of a virus from Mars reveals that it has 48% A, 48% T, and 4% G, Suggest some possible structures for this DNA. I don't quite understand this question. All i can come to think about is that A pairs with T evenly and there will be G leaving out
January 20, 2015 by Alessandra

Why are twin studies valuable in behavioral genetics research? What does the research say about the effects of environment on IQ scores in poor homes versus affluent homes? What does this suggest?
November 3, 2007 by Christian

  1. Pages:
  2. 1
  3. 2
  4. 3
  5. 4
  6. Next>>