Number of results: 437
Psychology
Yes, genetics is an important possible factor in addiction. Here is a site on that. http://learn.genetics.utah.edu/units/addiction/genetics/
Tuesday, June 3, 2008 at 12:42pm by GuruBlue
Genetics
This i s not my area, but you might like to have some of the following Genetics Tutorials: https://www.google.com/search?q=Genetics+Tutorials&ie=utf-8&oe=utf-8&aq=t&rls=org.mozilla:en-US:official&client=firefox-a Sra
Thursday, November 10, 2011 at 3:08am by SraJMcGin
Genetics
You might like to have some of the following links on Genetics Tutorials: http://search.yahoo.com/search?fr=mcafee&p=Genetics+tutorials Sra
Monday, October 31, 2011 at 1:23am by SraJMcGin
science
I would recommend finding a journal database related to genetics, and looking at a current issue. You can see a lot of findings there. If you don't have access to these from your school library, try googling Journal Genetics.
Friday, March 19, 2010 at 12:17pm by anony mouse
Accounting-- any comments please
Mendel is the father of modern genetics, but there are some genetic characteristics that cannot be explained by simple Mendelian genetics. Such is the case with the human blood types in which there are 3 alleles for the same gene, A B, and o. A parent can pass allele A, B, or ...
Monday, August 7, 2006 at 10:46am by Anonymous
biology
genetics offers diversity (many different combinations of DNA were involved), and mutations occured also. So, with all this diversity in genetics, some of the adaptations might lend favorable to reproduction, or fitness to survive. Those adaptations then will reproduce at a ...
Friday, August 12, 2011 at 5:38pm by bobpursley
SCIENCE
http://en.wikipedia.org/wiki/Genetics
Friday, May 22, 2009 at 12:31pm by Ms. Sue
Biology 101
Try some of the following links on Genetics: http://search.yahoo.com/search?fr=mcafee&p=summarize+inheritance+of+sex-linked+traits+through+meiosis+%26+how+it+relates+to+genetics Sra
Tuesday, October 26, 2010 at 4:26pm by SraJMcGin
Biology
Do you know what the terms, "dominant" and "recessive" mean? http://en.wikipedia.org/wiki/Dominance_(genetics)
Saturday, March 24, 2012 at 8:10pm by PsyDAG
SCIENCE
It can be genetics, but also offspring learn from their parents. The more complex the organism, the greater the role of learning. Thus the characteristics of higher level organisms are developed from a complex interaction between genetics and life experiences. One of the main ...
Friday, May 22, 2009 at 12:31pm by PsyDAG
Biology Genetics
The sperms would then reflect the genetics received from each paternal grandparent, one set from paternal grandpa and one from paternal grandma, as it was in the conception of the father. However, would you have that same factor in the development of the ovum, or would there ...
Monday, March 30, 2009 at 6:54pm by PsyDAG
How to do a big punnet square
http://www.changbioscience.com/genetics/punnett.html for the example square, use genotype at the last choice (3 types) x 3types, press go.
Wednesday, May 20, 2009 at 7:28pm by bobpursley
Genetics
Here are some tutorials you might like: http://www.google.com/search?q=Genetics+tutorial&ie=utf-8&oe=utf-8&aq=t&rls=org.mozilla:en-US:official&client=firefox-a Sra
Friday, September 2, 2011 at 4:21pm by SraJMcGin
Science
Yes. See http://library.thinkquest.org/20830/Textbook/Genetics.htm I hope this helps. Thanks for asking.
Wednesday, January 9, 2008 at 4:00pm by PsyDAG
Biology
Here are some Genetics Tutorials to look through: http://www.google.com/search?q=Genetics+tutorials&ie=utf-8&oe=utf-8&aq=t&rls=org.mozilla:en-US:official&client=firefox-a Sra
Friday, September 16, 2011 at 12:52pm by SraJMcGin
science(biology)
http://learn.genetics.utah.edu/content/begin/traits/blood/
Friday, March 25, 2011 at 1:54pm by TutorCat
Biology
http://www.emunix.emich.edu/~rwinning/genetics/chrom.htm
Saturday, June 5, 2010 at 6:30pm by Ms. Sue
Genetics/Biology
Here are some places to try: http://www.google.com/search?q=on+genetics%2C+recombination+frequencies&ie=utf-8&oe=utf-8&aq=t&rls=org.mozilla:en-US:official&client=firefox-a Sra
Thursday, March 18, 2010 at 5:20pm by SraJMcGin
7th grade science
How about the Tasmanian Devil. http://www.brighthub.com/science/genetics/articles/13897.aspx
Tuesday, January 4, 2011 at 1:05am by Dr Russ
Ag. Bio
Translation in genetics means "the decoding of an mRNA message". Like you would translate a phrase in a foreign language(like Spanish)to English,a process is used to translate the code of an mRNA message into a protein. The word Transcription in genetics is like &...
Wednesday, April 14, 2010 at 11:54pm by Anonymous
Science
Try here: http://search.yahoo.com/search?fr=mcafee&p=how+are+the+structures+in+genetics+related Sra
Tuesday, October 5, 2010 at 9:58pm by SraJMcGin
Science
What is the purpose on DNA This is a very interesting article on the purposes of DNA. http://www.vivo.colostate.edu/hbooks/genetics/medgen/dnatesting/index.html
Friday, July 27, 2007 at 4:47pm by Jason
Genetics
A homozygous pea plant with round peas and yellow cotyledons was crossed to a wrinkled, green plant. The F1 was selfed and produced: 193 round, yellow 69 round, green 64 wrinkled, yellow 26 wrinkled, green a) propose hypothesis that allows you to calculate expected values ...
Friday, September 2, 2011 at 4:21pm by Tommy
biology
http://www.paternityangel.com/Articles_zone/Blood/BloodType2.htm http://209.85.165.104/search?q=cache:EBt1hadaT20J:genetics.web.emory.edu/pdf/factsheet43.pdf+genetics,+blood+type&hl=en&ct=clnk&cd=7&gl=us&ie=UTF-8
Saturday, March 15, 2008 at 3:18pm by GuruBlue
science
http://www.brighthub.com/science/genetics/articles/41927.aspx
Thursday, March 31, 2011 at 7:39pm by Ms. Sue
biology
http://www.dobermann-review.com/info/genetics/punnet_square/psquar2b.jpg
Wednesday, April 14, 2010 at 9:15pm by bobpursley
Biology 101
Please look at some of the following links: http://search.yahoo.com/search?fr=mcafee&p=how+are+meiosis+%26+genetics+related%3F Sra
Monday, October 25, 2010 at 5:19pm by SraJMcGin
Genetics
Thank you!
Sunday, August 21, 2011 at 7:12pm by Gabe
Genetics
yes.
Wednesday, November 4, 2009 at 4:03pm by bobpursley
genetics
jkn
Monday, September 24, 2007 at 9:30pm by Anonymous
Genetics/Biology
That doesn't help.
Thursday, March 18, 2010 at 5:20pm by Sonya
Genetics
yay guelph
Sunday, March 6, 2011 at 8:15pm by sam
psychology
race and genetics.
Wednesday, November 2, 2011 at 9:28pm by bobpursley
biology genetics
What is your question?
Sunday, October 16, 2011 at 4:25pm by PsyDAG
Genetics
Whats a homolog?
Monday, November 3, 2008 at 9:46pm by Lena
Bio Anatomy
http://www.google.com/#hl=en&sclient=psy-ab&q=genetics+of+occipital+lobe+epilepsy&oq=genetics+of+occipital+lobe+epilepsy&aq=f&aqi=&aql=1&gs_nf=1&gs_l=serp.3...1133416.1141538.1.1143637.5.5.0.0.0.0.105.402.4j1.5.0.cqn%2Ccconf%3D0-95%2Cmin_length%...
Sunday, April 22, 2012 at 1:57pm by Ms. Sue
Genetics
i = 0.0582 ii=0.0009 b) 3
Wednesday, March 27, 2013 at 1:00am by Anonymous
Genetics
See your later post.
Thursday, March 21, 2013 at 8:15pm by Devron
Genetics 7th
female is dominant
Thursday, December 13, 2012 at 2:08am by Joshua
Biology - genetics
Assistance needed.
Thursday, November 24, 2011 at 7:20pm by Writeacher
Genetics
I don't get b or c at alll. What are the u's and a's? What are the exclamation points?
Friday, September 2, 2011 at 2:10pm by Tommy
Genetics
I bet your in my class at guelph.
Sunday, March 6, 2011 at 8:15pm by sean
Science
How are the structures in genetics related?
Tuesday, October 5, 2010 at 9:58pm by Jack
scientist
it eliminates the variable of genetics.
Friday, September 10, 2010 at 5:47pm by bobpursley
Genetics
the transcription would stop.
Monday, September 24, 2007 at 12:38pm by bobpursley
science
Mitosis is normal cell division for body cells. Do mean the difference between meiosis and mitosis? I searched Google under the key words "meiosis and mitosis" to get these possible sources: http://www.pbs.org/wgbh/nova/miracle/divide.html http://www.animalgenome.org...
Saturday, October 17, 2009 at 3:47pm by PsyDAG
Psych
Let's look at your first four sentences. It is inconsistent << inconsistent with what? to think that behaviors are solely due to our genetic make-up. When it comes to our behaviors we gain it through nature and nature. << is this what you mean? ...
Friday, January 30, 2009 at 2:38pm by Ms. Sue
Psychology
What do genetics and evolution mainly involve?
Wednesday, August 1, 2012 at 8:39pm by PsyDAG
bilogy(genetics
you need to do a punnett square
Friday, November 5, 2010 at 2:59pm by annonomus
leeds middle school
monster genetics
Wednesday, December 6, 2006 at 10:26pm by anyae
6th grade genetics
What is your question?
Tuesday, May 26, 2009 at 9:07pm by Ms. Sue
science
why are karyotypes important tools for genetics?
Tuesday, May 12, 2009 at 5:37pm by Anonymous
Genetics
We use more dilute cultures because
Saturday, March 31, 2007 at 10:59am by Anonymous
bio : fundamentals of genetics
Dominant:recessive
Sunday, June 1, 2008 at 9:31pm by bobpursley
genetics
need help with these genetics problems. please help with what you can. thanks: Given that loci A and B in Drosophila are sex-linked and 20 map units apart, what phenotypic frequencies would you expect in male and female offspring resulting from the following crosses? (Assume A...
Monday, September 24, 2007 at 9:30pm by stew
science
Is this what you're looking for? http://ghs.gresham.k12.or.us/science/ps/sci/soph/genetics/notes/sexlinked.htm
Tuesday, April 15, 2008 at 7:03pm by Ms. Sue
Psych
CAN SOMEONE REVIEW MY ANSWERS AND TELL ME IF THIS IS CORRECT? Why is it flawed to ask how much of a particular behavior is due to genetics and how much is due to experience? It is inconsistent to think that behaviors are solely due to our genetic make-up. When it comes to our ...
Friday, January 30, 2009 at 2:38pm by SinnerSaved
Sci230
http://www.usoe.k12.ut.us/CURR/SCIENCE/sciber00/7th/genetics/sciber/compare.htm
Wednesday, July 23, 2008 at 10:46pm by Ms. Sue
Genetics part b only
answer this question please
Tuesday, April 2, 2013 at 4:34pm by DOPE
Biology 101
How are meiosis and genetics related?
Monday, October 25, 2010 at 5:19pm by Anita fields
science
What is a result of scientific research in the field of genetics
Friday, March 19, 2010 at 12:17pm by Melanie
Genetics
We seem to have no experts in that field who are qualified to help you.
Thursday, November 20, 2008 at 10:53pm by drwls
biology
Are an organism's characteristics determined only by its genes? Explain. Yes, an organism's characteristics are determined only by It's genes becuase the parents give their offspring genes which determines their characteristics. Is my answer correct? Do I need to ...
Sunday, February 25, 2007 at 6:35pm by franny
Genetics
this is validation of EDX course.. do problem sets yourself! cheater!
Thursday, March 21, 2013 at 2:39am by fungus
Genetics
Please give the genotypes of the parents here, so we can respond.
Friday, November 23, 2012 at 11:06am by PsyDAG
genetics
Also, how would this affect the connection of DNA and the histones?
Sunday, October 14, 2012 at 7:31pm by ren
early childhood
evolutionary psychology and behavior genetics: watson
Thursday, February 23, 2012 at 3:45pm by jen
Genetics
Sorry, not value.. I need an approximate length... in Angstroms.
Monday, October 31, 2011 at 1:23am by Kyle
Genetics
Can chromosome instability cause an individual to be highly susceptible to cancer?
Saturday, October 3, 2009 at 6:47pm by Sarah
biology
how does the urinary system support reproduction and passing on genetics?
Saturday, June 27, 2009 at 8:00pm by Liz
6th grade genetics
I think that would be called heredity.
Tuesday, May 26, 2009 at 9:07pm by Kim
6th grade genetics
transferring a gene from one organism to another
Tuesday, May 26, 2009 at 9:07pm by kay
science
I am looking for my study guide - what ends translation ( genetics)
Wednesday, March 18, 2009 at 12:24am by sam
health
you are correct. Genetics plays a strong role in alcoholism
Wednesday, November 19, 2008 at 5:29pm by DanH
Genetics
I think its the frequency of the gene this is a Hardy-Weignberg problem Thanks!
Thursday, November 13, 2008 at 3:01pm by Keira
Genetics
emobroyonic? Please check your spelling and repost. Sra
Monday, November 3, 2008 at 9:50pm by SraJMcGin
Science
I need help finding out How does genetics benefit medicine?
Sunday, January 13, 2008 at 11:19pm by Zoey
genetics
What kinds of amino acids on histone tails are able to be phosphorylated and why?
Sunday, October 14, 2012 at 7:31pm by ren
Biology - genetics
How does crossing over change the combination of alleles in gametes? Thanks :)
Thursday, August 23, 2012 at 3:01am by Cally
SCIENCE (GENETICS)
if there are two forms of each of the seven traits, how many possible combinations are there?
Wednesday, May 23, 2012 at 10:41pm by JEN
Genetics
In general, what two methods are used to grow bacteria in the laboratory?
Wednesday, February 8, 2012 at 10:12am by Anon
human Genetics
In a mouse cell at the start of mitosis, how many chromatids are present?
Thursday, September 15, 2011 at 9:59pm by kay
Genetics
what is the chance of a woman having five female children in a row?
Wednesday, January 9, 2008 at 3:58pm by Matthew
genetics
check my thinking. Parent one is homozygous in dominant, and parent two is homozygous in recessive. Therefore F1 cannot be anything but heterozygous.( AaBbCcDdEe), one genotype. Now in F2, each parent will contribute either dominant or recessive, so there are three types in ...
Friday, September 12, 2008 at 1:18pm by bobpursley
Genetics
The following DNA segment has one ORF. Do you know what it codes for? 5'-TAGGATGTTCGACATGTAAGCTT ATCCTACAAGCTGTACATTCGAA
Thursday, November 10, 2011 at 3:08am by Tony
7th grade science
Why was Gregor Mendel given the title "The Father Of Genetics" ?
Sunday, December 13, 2009 at 6:26pm by mary
genetics
Adenine would not have a bonding partner. Tell me more please.
Wednesday, October 28, 2009 at 10:07pm by BranditoOeste
genetics
What would happen during DNA replication if there were no thymine nucleotides available?
Wednesday, October 28, 2009 at 10:07pm by sam
quick science question
What are some ways in which genetics collect samples to test for disorders?
Friday, August 28, 2009 at 5:41pm by Lauren
Biology-genetics
We will be interested to see what YOUR answers are. Then we will give you further suggestions if needed. We do not do your work for you.
Monday, June 16, 2008 at 4:17pm by GuruBlue
Genetics
its really easy...just do it like probability and keep in mind that p+q=1 and 2pq= Aa
Wednesday, March 27, 2013 at 1:00am by Jing Chen
Biology 101
summarize the inheritance of sex-linked traits through meiosis and how it relates to genetics.
Monday, October 25, 2010 at 3:26pm by sarah
7th grade science
name two scientest who studied inherited genetics and what they used for research and why
Tuesday, November 17, 2009 at 4:06pm by alice
Bio-Chemistry
Try this site for help. learn.genetics.utah.edu/content/begin/dna/transcribe
Tuesday, August 18, 2009 at 6:05am by Kimberly
eth
We'll be happy to read your response and comment on it. You might look at genetics, hopelessness, and unemployment.
Wednesday, December 10, 2008 at 6:57pm by Ms. Sue
Biology 101
Summarize the inheritance of sex-linked traits through meiosis and how it relates to genetics.
Tuesday, October 26, 2010 at 4:26pm by Anita fields
Biology 101
Summarize the inheritance of sex-linked traits through meiosis and how it relates to genetics.
Monday, October 25, 2010 at 3:26pm by Anita fields
psychology
I think the main one is genetics, but I am freely admitting many will disagree. It is hard to dig a deep well in sand.
Sunday, July 11, 2010 at 12:14pm by bobpursley
the subject is genetics
The Google search link you have been provided will offer you many sites to answer whatever your question is
Wednesday, January 21, 2009 at 3:50pm by drwls
Science - biology - university
I searched Google under "albino genetics" to get http://www.google.com/search?client=safari&rls=en&q=albino+genetics&ie=UTF-8&oe=UTF-8 Here is info from one source: When both parents carry the gene and neither of them have albinism (carriers), then ...
Monday, September 27, 2010 at 1:43pm by PsyDAG
Pages: 1 | 2 | 3 | 4 | 5 | Next>>
For Further Reading