Tuesday
July 29, 2014

Search: Genetics

Number of results: 278

Criminal Justice
Discuss the merits of the idea that genetics are a source for criminal behavior. Make sure to provide examples that can be found through research studies and have evidence linking genetics and crime, including twin studies, adoption studies, and testosterone studies. What are ...
September 8, 2013 by Danita

Genetics
A homozygous pea plant with round peas and yellow cotyledons was crossed to a wrinkled, green plant. The F1 was selfed and produced: 193 round, yellow 69 round, green 64 wrinkled, yellow 26 wrinkled, green a) propose hypothesis that allows you to calculate expected values ...
September 2, 2011 by Tommy

genetics
need help with these genetics problems. please help with what you can. thanks: Given that loci A and B in Drosophila are sex-linked and 20 map units apart, what phenotypic frequencies would you expect in male and female offspring resulting from the following crosses? (Assume A...
September 24, 2007 by stew

Genetics
Whats a homolog?
November 3, 2008 by Lena

Science
How are the structures in genetics related?
October 5, 2010 by Jack

science
why are karyotypes important tools for genetics?
May 12, 2009 by Anonymous

Biology 101
How are meiosis and genetics related?
October 25, 2010 by Anita fields

Psych
CAN SOMEONE REVIEW MY ANSWERS AND TELL ME IF THIS IS CORRECT? Why is it flawed to ask how much of a particular behavior is due to genetics and how much is due to experience? It is inconsistent to think that behaviors are solely due to our genetic make-up. When it comes to our ...
January 30, 2009 by SinnerSaved

Science, Genetics
Please help me with science genetics questions? Thanks to all who answer. :) 1. Chromosome pairs contain different versions of genes, which are called ________. 2. The process in which body cells are duplicated in order to grow and repair body tissues is called _____________. ...
March 10, 2014 by Hannah

science
What is a result of scientific research in the field of genetics
March 19, 2010 by Melanie

biology
Are an organism's characteristics determined only by its genes? Explain. Yes, an organism's characteristics are determined only by It's genes becuase the parents give their offspring genes which determines their characteristics. Is my answer correct? Do I need to expand on ...
February 25, 2007 by franny

science
I am looking for my study guide - what ends translation ( genetics)
March 18, 2009 by sam

6th grade genetics
transferring a gene from one organism to another
May 26, 2009 by kay

biology
how does the urinary system support reproduction and passing on genetics?
June 27, 2009 by Liz

Genetics
Can chromosome instability cause an individual to be highly susceptible to cancer?
October 3, 2009 by Sarah

Genetics
Can you help me determine the phenotype and proportions expected from these crosses in chickens? a) RR Pp x rr Pp b) rr PP x Rr Pp c) Rr Pp x Rr pp
September 9, 2011 by Tommy

early childhood
evolutionary psychology and behavior genetics: watson
February 23, 2012 by jen

biology - genetics
is the cis-regulatory sequence found in the exome?
March 26, 2014 by santoki

Please Help Me :( Science: Biology, Genetics!
Please help me with science genetics questions? Thanks to all who answer!! :) 1. Chromosome pairs contain different versions of genes, which are called ________. 2. The process in which body cells are duplicated in order to grow and repair body tissues is called _____________...
March 10, 2014 by Hannah

Genetics
what is the chance of a woman having five female children in a row?
January 9, 2008 by Matthew

human Genetics
In a mouse cell at the start of mitosis, how many chromatids are present?
September 15, 2011 by kay

Genetics
In general, what two methods are used to grow bacteria in the laboratory?
February 8, 2012 by Anon

SCIENCE (GENETICS)
if there are two forms of each of the seven traits, how many possible combinations are there?
May 23, 2012 by JEN

Biology - genetics
How does crossing over change the combination of alleles in gametes? Thanks :)
August 23, 2012 by Cally

genetics
What kinds of amino acids on histone tails are able to be phosphorylated and why?
October 14, 2012 by ren

genetics
What would happen during DNA replication if there were no thymine nucleotides available?
October 28, 2009 by sam

7th grade science
Why was Gregor Mendel given the title "The Father Of Genetics" ?
December 13, 2009 by mary

Genetics
The following DNA segment has one ORF. Do you know what it codes for? 5'-TAGGATGTTCGACATGTAAGCTT ATCCTACAAGCTGTACATTCGAA
November 10, 2011 by Tony

Biology -Genetics
True or False X and Y chromosomes are found only in eggs and sperm. T or F ?
March 5, 2014 by Amy

quick science question
What are some ways in which genetics collect samples to test for disorders?
August 28, 2009 by Lauren

7th grade science
name two scientest who studied inherited genetics and what they used for research and why
November 17, 2009 by alice

Biology 101
Summarize the inheritance of sex-linked traits through meiosis and how it relates to genetics.
October 25, 2010 by Anita fields

Biology 101
Summarize the inheritance of sex-linked traits through meiosis and how it relates to genetics.
October 26, 2010 by Anita fields

Genetics
What is an approximate value of the length of a 30 nm fiber that contains 120,000 nucleotide pairs of DNA?
October 31, 2011 by Kyle

bio : fundamentals of genetics
A 3:1 ratio of tall to short plants in the F2 generation lends support to the principle of ________________.
June 1, 2008 by Henry

biology
In reference to plant and animal adaptations, how are the principles of heredity and genetics applicable to how organisms change over time?
August 12, 2011 by Anonymous

GBE (Genetics)
What are the advatages of Eukaryotic genes splitting up? I'm not so sure how to approach the question, is it something to do with exons & introns or the nucleotide sequences?
October 7, 2008 by Claire

psychology
If you had to argue that either genetics (nature) or environment (nurture) has the greater impact on human development, which would you pick and why?
March 1, 2011 by Rica

law ans ethics in allied health
the science of improving hededitary is known as a.genetics b.amniocentesis c.dna research d.eugenics my answer is a
November 10, 2013 by susue

psychology
humanistic therapy acknowledge unconscious forces and --- as a source of personal difficulties environment negative thoughts genetics psychosis please help
April 16, 2012 by kevin

Genetics
Question: Calculate the frequency of the AA, Aa, and aa genotypes after one generation if the initial population consists of 0.2 AA, 0.6 Aa, and 0.2 aa. What I have done is: P = (0.2)+(0.5)(0.6)= 0.50 q = 1-p = 1 - 0.50 = 0.50 Can someone check my answer plz.
December 6, 2006 by Josh

biology
studying genetics in mammals where can i find out about felines and canines that are proven mainly allergen free, thought not genetically modified?
September 22, 2009 by elizabeth

Biology!!
The lifespan of plants varies depending on genetics and survival strategies. Discuss the adaptive value of annual, biennial, and perennial life spans.
January 26, 2011 by NEEDS HELP!!

genetics
Given the gene sequence ABCDE, crossing over should occur most frequently between_____. a. A-B b.) B-C c.) A-E d.) A-D e.) A-C PLEASE explain how you got the answer thanks!
October 26, 2013 by nini

genetics
Suppose that for an organism, 2N = 8. How many chromosomes do the organism's gametes contain? Would it be 8?
February 25, 2007 by franny

biology
How does the circulatory system and the lymphatic system support reproduction and passing along genetics?
June 27, 2009 by Liz

genetics
Once the _______ checkpoint is passed in the cell cycles, the cell is committed to division
May 14, 2013 by Anonymous

Genetics
if a start codon changes into a stop codon, how would this effect transcription? please help.
September 24, 2007 by Sara

science (Genetics and Evolution)
What contains DNA? Where is DNA found? What is the difference between phenotype and genotype?
May 3, 2011 by jason

Genetics
What is the difference between genetic inheritance and epigenetic inheritance?
September 9, 2011 by Tommy

Genetics
1) Do you know if the nucleotide sequence of a mutation tell you anything about its dominance or recessiveness? 2) Do you know the role that Ras play in the signal transduction pathway that makes it an oncogene?
November 4, 2011 by Bobby

Genetics
Hi, Is it possible to have a recombination frequency greater than 50%? the answer would be yes as they would assort indepnedyt? correct? thanks
December 7, 2008 by Sandy

Genetics 160
Using D for tall plants and d for dwarf plants, a 1:1 ratio is obtained in which of the following crosses? These are my choices: Dd X dd DD X dd DD X Dd DD X DD Dd X Dd
September 29, 2013 by Julie

Bio- Genetics Quest.
A freind of yours brings up the idea that, if a person's gene were all identified and sequenced, he would be able to tell everything about that person: what they look like, how they might act, even how they will progess in life, and how long they would likely live. Is this ...
April 22, 2007 by Richard

Genetics
Name the term used to describe the phenomenon in which a bacteriophage genome incorporates its genome into the chromosome of the host.
February 8, 2012 by Anon

genetics
Can anyone help me with Genetics? I have some problems and answers and need them explained to me. Here are some of the questions and answers: 1. Assume that a dihybrid cross is made in which the genes' loci are autosomal, independantly assorting, and incompletely dominant. How...
September 8, 2007 by frank

Child psychology
Studies on the development of sexual orientation highlight the importance of A.genetics B. environment C. prenatal hormones D. multiple factors I said A the enviroment, Now thinking its D
August 26, 2010 by Anonymous 2

Genetics/Di hybrid Cross
Can someone show me how to set up this dihybrid cross? The genotypes of the two parents are RRLL' x RWL'L'. The " ' " meaning "prime."
January 18, 2010 by Anonymous

psychology
1.Identify a typical developmental milestone for a person at a specific stage and explain how achievement of this milestone might be impacted by genetics and environment.
May 26, 2012 by Anonymous

Genetics
What are three sources of emobroyonic stem cells and how are they obtained from each? This is what I have so far: 1. Blasocyst of an embyro 2. Embilical cord of a baby 3. ? I don't understand how to explain how to obtain them. Don't you just remove them?
November 3, 2008 by Lena

School advice please
What medical research field is in more demand? If I want to get a masters, what would you recommend me taking in undergrad between physiology, biochemistry, genetics, neuroscience or biotechnology?
July 21, 2009 by Alex

genetics
i have a diploid cell with 3 pairs of homologous chromosomes A1,A2,B1,B2,C1,C2 with no crossing over. will my daughter cells after mitosis just be [A1,B1,C1] and [A2,B2,C2] or will there be a mix between the 1's and 2's creating more varieties?
September 27, 2013 by Anonymous

genetics
______________ means that neither gene in a gene pair (genotype) masks the other. As a result, the traits carried by the 2 genes appear to be blended.
October 13, 2008 by sara

Genetics
starting with 1000 copies of a template, 35 cycles of PCR were performed. What is the theoretical yield of copies of double stranded product of this amplification reaction?
November 27, 2012 by Josh G.

Genetics
Phenylketonuria is a metabolic disease of humans that results from an autosomal recessive gene. If the frequency of phenylketonurics in the population is 9/10,000, what is the probability that two normal individuals will produce a diseased child?
November 13, 2008 by Keira

psychology
THE ABILITY TO SOLVE ABSTRACT PROBLEMS SUCH AS THOSE FOUND IN ALGEBRA AND HIGHER MATHEMATIC IS INFLUENCED BY BOTH DEVELOPMENT AND A)GENETICS B)SOCIETAL FACTORS C)HEALTH D)COGNITIVE STYLE
July 11, 2010 by fred

child psychology
The ability to solve abstact problems such as those found in algebra and higher mathematics is influenced by devdlopment and A. genetics B. societal factors C. health D. cognitive style
August 25, 2010 by Anonymous

Genetics
Describe the inheritance and expression of cystic fibrosis, Tay-Sachs disease and sickle-cell anemia. I didn't understand what the question meant by "expression." Please help!
February 24, 2008 by Anonymous

Science (Genetics)
How many males in America have brown eyes, green eyes, and/or blue eyes?
October 14, 2008 by Mariz

AP BIOLOGY
I have a quiz on genetics on friday in AP Biology and I would like some sites with good ap biology questions on them. I don't know any of them which I could go to.
December 3, 2008 by Roger

biology
how does the existence of cells, organelles, cellular reproduction, natural selection, DNA replication, transcription, translation, heredity, genetics, mutations, and taxonomy provide evidence that supports the theory of evolution?
June 15, 2008 by Aneesah

psychology
How is personality developed? What roles do genetics and environment play in personality development? How do experiences influence personality? How is a person motivated?
April 27, 2010 by Mike

population genetics
In a population where 8% of the men are red-green colour blind, what are the expected proportions of genotypes for the males and females? (Assume the trait does not affect survival or fertility.)
November 13, 2008 by lianne

Genetics/Biology
Recombination frequencies a. arise from completely random genetic exchange. b. are the same for all genes. c. decrease with distance. d. are the same for cis and trans heterozygotes.
March 18, 2010 by Sonya

health
identify major factors that influence fitness potential. Thanks!! roy/cindy genetics, health, age, are some that come to mind. Do you not have a class text book?
November 14, 2006 by roy

bilogy(genetics
given the following genotypes GgWwTt and GgWWtt. what is the probability of producing an offspring with the following genotype? How do i solve this problem?
November 5, 2010 by lou

psychology
evolutionary psychology and behavior genetics a. have little in common b. acknoweledge the interactions of heredity and evirronment c. focus on lerning and experience d. are two schools of thought first introduced by john b. watson
August 1, 2013 by meka

Genetics
A male with singed bristles (sn) appeared in a culture of Drosophila. How would you determine if this unusual phenotype was due to an X-linked mutation? Can you show the crosses that you would do to determine this?
September 9, 2011 by Tommy

genetics/biology
I am having trouble wording this question. Describe the differences in the outcomes for a dihybrid cross ifgenes are: a. completely linked b. completely unlinked c. incompletely linked.
April 15, 2012 by Lucylu

PSYCHOLOGY
Evolutionary psychology and behavior genetics: A have little in common B acknowledge the interaction of heredity and environment C focus on learning and experience D are two schools of thought first introduced by John B.Watson, Is B maybe correct?
September 16, 2009 by 888

Psychology
Why are twin studies valuable in behavioral genetics research? What does the research say about the effects of environment on IQ scores in poor homes versus affluent homes? What does this suggest?
November 3, 2007 by Christian

genetics
you want to build a protein that is 10 amino acids long with the number of different amino acid that can be used how many unique protein could you7 construct.? B)How would this information be encode in your genome?
September 12, 2008 by rich

Biology
So I am completely confused. I am in the process of taking a quiz and the question says "a factor that seems to disappear" my options are punnet square, heredity, dominant factor, recessive factor, alleles, or genetics??? Help please? Thanks
January 10, 2013 by lazyburrito

Science (Genetics)
In children, whose eye color (mom or dad) do they inherit more often? I know it all depends on which color is dominant, but in all [as in statistics in the US], is there any place where I can find this information? Thanks!
October 14, 2008 by Mariz

Psychology
Evolutionary psychology and behavior genetics: a) have little in common b)acknowledge the interaction of heredity and environment c)focus on learning and experience d)are two schools of thought first introduced by John B. Watson I am confused between B and D
August 22, 2010 by Rena

psy - revise please
match -Psychodynamic Theory -Trait Theory -Learning Theory -Humanistic Theory -Sociocultural B. Popular theorist eysenck initiated the five-factor model. Ans:Trait theory C. The healthy personality is found in balancing the sociol self with the individual self. Ans: ...
April 20, 2008 by rose - Ms. Sue

Bio Bio Please check answer
Because codons are triplicates, there are ______ possible nucleotides combinations that could make a codon; each giving rise to one specific amino acid. Yet, there are only 20 amino acids used to produce proteins. Thsus, the gentic code is said to be _______. I. 16, unambigous...
July 22, 2006 by Christine

bio
Many studies have shown that extinction is a natural process that occurred long before humans ever evolved. Explain the importance of conservation genetics in the survival of endangered species. Why should we be so concerned about extinction now?
February 27, 2012 by Anonymous

genetics
In a village with 4300 people, 1 in 90 males has a condition called 5-ARD that causes men to be pseudo-hermaphroditic. What is the frequency of autosomal recessive 5-ARD allele in this village, assuming Hardy-Weinberg equilibrium?
October 1, 2012 by kat

genetics
How do you determine genotypes? The only way to determine genotypes is to know the parentage.
January 10, 2007 by Courtney

genetics
Assume that a cross is made between AaBb and aabb plants, and the offspring occur in the following numbers: 106 AaBb, 48 Aabb, 52 aaBb, 94 aabb. These results are consitent with which arrangement of genes?
September 23, 2007 by stew

A movie question
Has anyone seen the movie Gatacca? What has the title of that movie have to do with the genetics and stuff? What is the significance of that title?
June 10, 2010 by Sara

Genetics
How is it that someone with brown eyes could have parents, both with blue eyes? Aren't blue eyes recessive?
August 21, 2011 by Gabe

Biology - Genetics
I have not been able to find any more in depth websites/answers for this question. DNA is considered to be a relatively stable molecule. What is it that gives the molecule its stability when the hydrogen bonds between the nitrogen bases are so easily broken?
October 31, 2007 by Me-ki

Genetics
Hi, If a gene for neprilysin contains 80 000 base pairs, and neprilysin contains only 749 amino acids, can anyone explain the significance of the difference between the numbers ? Can anyone suggest a place where I can read more on this topic ? Thanks.....
May 25, 2008 by Lewis

genetics
2 organisms, AABBCCDDEE and aabbccddee are mated to produce an F1 that is self fertilized. If the capitol letters are dominant, independantly assorting alleles: A) how many different genotypes will occur in the F2? B)what portion of the F2 genotypes will be recessive for all ...
September 12, 2008 by mike

Genetics
A certain form of albinism in humans is recessive and autosomal. Assume that 1% of the individuals in a given population are albino. Assuming that the population is in Hardy-Weinberg equilibrium, what percentage of the individuals in this population is expected to be ...
March 15, 2012 by Anon

Genetics
A certain form of albinism in humans is recessive and autosomal. Assume that 1% of the individuals in a given population are albino. Assuming that the population is in Hardy-Weinberg equilibrium, what percentage of the individuals in this population is expected to be ...
March 18, 2012 by Anon

philosophy
Q: Sartre says that we are ______________ if we blame our nature or behavior on history, genetics, environment, or other people. a. being reasonable b. revealing a self-destructive impulse c. acting in an authentic manner d. acting in bad faith e. fighting for control Thank u! e
November 25, 2006 by John

Psychology
In the nature vs. nurture debate, what are some arguments that side with genetics (nature) being more influential on human development than human environment and experience (nurture)?
October 25, 2008 by Chrissy

Pages: 1 | 2 | 3 | Next>>

Search
Members