Post a New Question


387 results

7th G science
What is/are the main factor(s) that determine(s) the height of a plant (genetics, environment, or both)? Explain your answer. I think that only genetics play a role but I am not sure.

Criminal Justice
Discuss the merits of the idea that genetics are a source for criminal behavior. Make sure to provide examples that can be found through research studies and have evidence linking genetics and crime, including twin studies, adoption studies, and testosterone studies. What are ...

A homozygous pea plant with round peas and yellow cotyledons was crossed to a wrinkled, green plant. The F1 was selfed and produced: 193 round, yellow 69 round, green 64 wrinkled, yellow 26 wrinkled, green a) propose hypothesis that allows you to calculate expected values ...

What is Genetics?

need help with these genetics problems. please help with what you can. thanks: Given that loci A and B in Drosophila are sex-linked and 20 map units apart, what phenotypic frequencies would you expect in male and female offspring resulting from the following crosses? (Assume A...

Whats a homolog?

Relation b/w genetics and gp

How are the structures in genetics related?

why are karyotypes important tools for genetics?

Biology 101
How are meiosis and genetics related?

What is the function of a eukaryotic promoter sequence?

science (ASAP)
what does the notation TT mean to genetics

CAN SOMEONE REVIEW MY ANSWERS AND TELL ME IF THIS IS CORRECT? Why is it flawed to ask how much of a particular behavior is due to genetics and how much is due to experience? It is inconsistent to think that behaviors are solely due to our genetic make-up. When it comes to our ...

Science, Genetics
Please help me with science genetics questions? Thanks to all who answer. :) 1. Chromosome pairs contain different versions of genes, which are called ________. 2. The process in which body cells are duplicated in order to grow and repair body tissues is called _____________. ...

What is a result of scientific research in the field of genetics

Why is DNA replication termed semi conservative?

Are an organism's characteristics determined only by its genes? Explain. Yes, an organism's characteristics are determined only by It's genes becuase the parents give their offspring genes which determines their characteristics. Is my answer correct? Do I need to expand on ...

I am looking for my study guide - what ends translation ( genetics)

6th grade genetics
transferring a gene from one organism to another

how does the urinary system support reproduction and passing on genetics?

Can chromosome instability cause an individual to be highly susceptible to cancer?

Can you help me determine the phenotype and proportions expected from these crosses in chickens? a) RR Pp x rr Pp b) rr PP x Rr Pp c) Rr Pp x Rr pp

early childhood
evolutionary psychology and behavior genetics: watson

biology - genetics
is the cis-regulatory sequence found in the exome?

Please Help Me :( Science: Biology, Genetics!
Please help me with science genetics questions? Thanks to all who answer!! :) 1. Chromosome pairs contain different versions of genes, which are called ________. 2. The process in which body cells are duplicated in order to grow and repair body tissues is called _____________...

what is the chance of a woman having five female children in a row?

human Genetics
In a mouse cell at the start of mitosis, how many chromatids are present?

In general, what two methods are used to grow bacteria in the laboratory?

if there are two forms of each of the seven traits, how many possible combinations are there?

Biology - genetics
How does crossing over change the combination of alleles in gametes? Thanks :)

What kinds of amino acids on histone tails are able to be phosphorylated and why?

why are there not many clinical studies done on rare diseases such as Batten disease?

What would happen during DNA replication if there were no thymine nucleotides available?

7th grade science
Why was Gregor Mendel given the title "The Father Of Genetics" ?

The following DNA segment has one ORF. Do you know what it codes for? 5'-TAGGATGTTCGACATGTAAGCTT ATCCTACAAGCTGTACATTCGAA

Biology -Genetics
True or False X and Y chromosomes are found only in eggs and sperm. T or F ?

quick science question
What are some ways in which genetics collect samples to test for disorders?

7th grade science
name two scientest who studied inherited genetics and what they used for research and why

Biology 101
Summarize the inheritance of sex-linked traits through meiosis and how it relates to genetics.

Biology 101
Summarize the inheritance of sex-linked traits through meiosis and how it relates to genetics.

What is an approximate value of the length of a 30 nm fiber that contains 120,000 nucleotide pairs of DNA?

BIO 101
Summarize the inheritance of sex-linked traits through meiosis and how it relates to genetics.

bio : fundamentals of genetics
A 3:1 ratio of tall to short plants in the F2 generation lends support to the principle of ________________.

Does anyone know a good website that covers aspects of human genetics? If so can i have the link and a summary of the site's content. thank you

what factor can influence obesity? A. genetics B. hormones C. environment D. all of the above my best answer is D is that correct

In reference to plant and animal adaptations, how are the principles of heredity and genetics applicable to how organisms change over time?

GBE (Genetics)
What are the advatages of Eukaryotic genes splitting up? I'm not so sure how to approach the question, is it something to do with exons & introns or the nucleotide sequences?

If you had to argue that either genetics (nature) or environment (nurture) has the greater impact on human development, which would you pick and why?

law ans ethics in allied health
the science of improving hededitary is known as a.genetics b.amniocentesis c.dna research d.eugenics my answer is a

Biology - Genetics
If genes a, b, c, and d are genetically linked to each other, does it follow that a recombination experiment would detect genetic linkage between a and d?

Are there any websites that explain Mendelian genetics and show how to solve such problems in an easy, concise manner at an AP Bio level? Thank you

My bad! I put the wrong question! Here we go, the shortened one! ~~~~~~~~~~~~~~ How do nucleotides and hydrogen bonds affect the structure of DNA. ~~~~~~~~~~~~~~

humanistic therapy acknowledge unconscious forces and --- as a source of personal difficulties environment negative thoughts genetics psychosis please help

1. How is sex expressed at the chromosomal, gonadal, phenotypic, and gender identity levels? How do genes in the pseudoautosomal region of the Y chromosome differ from X-Y homologs?

which do you think was the more far-reaching accomplishment, determining the structure of dna, or sequencing the human genome? state a reason for your answer

With PCR, one gene is all that is necessary to create a useful genetic fingerprint to discriminate between individuals. True False

Question: Calculate the frequency of the AA, Aa, and aa genotypes after one generation if the initial population consists of 0.2 AA, 0.6 Aa, and 0.2 aa. What I have done is: P = (0.2)+(0.5)(0.6)= 0.50 q = 1-p = 1 - 0.50 = 0.50 Can someone check my answer plz.

studying genetics in mammals where can i find out about felines and canines that are proven mainly allergen free, thought not genetically modified?

The lifespan of plants varies depending on genetics and survival strategies. Discuss the adaptive value of annual, biennial, and perennial life spans.

Given the gene sequence ABCDE, crossing over should occur most frequently between_____. a. A-B b.) B-C c.) A-E d.) A-D e.) A-C PLEASE explain how you got the answer thanks!

Suppose that for an organism, 2N = 8. How many chromosomes do the organism's gametes contain? Would it be 8?

How does the circulatory system and the lymphatic system support reproduction and passing along genetics?

Once the _______ checkpoint is passed in the cell cycles, the cell is committed to division

if a start codon changes into a stop codon, how would this effect transcription? please help.

science (Genetics and Evolution)
What contains DNA? Where is DNA found? What is the difference between phenotype and genotype?

Wild type, or wt, refers to the genotype that is the typical genotype found in nature. True False

What is the difference between genetic inheritance and epigenetic inheritance?

1) Do you know if the nucleotide sequence of a mutation tell you anything about its dominance or recessiveness? 2) Do you know the role that Ras play in the signal transduction pathway that makes it an oncogene?

how human behavior may be genetically inherited from remote ancestors. Her field of interest is A. chemical psychobiology. B. evolutionary psychology. C. clinical neuropsychology. D. behavioral genetics.

Hi, Is it possible to have a recombination frequency greater than 50%? the answer would be yes as they would assort indepnedyt? correct? thanks

Genetics 160
Using D for tall plants and d for dwarf plants, a 1:1 ratio is obtained in which of the following crosses? These are my choices: Dd X dd DD X dd DD X Dd DD X DD Dd X Dd

What are the key characteristics of a model organism? Name atleast 3 different model organisms used in genetics.

Bio- Genetics Quest.
A freind of yours brings up the idea that, if a person's gene were all identified and sequenced, he would be able to tell everything about that person: what they look like, how they might act, even how they will progess in life, and how long they would likely live. Is this ...

Name the term used to describe the phenomenon in which a bacteriophage genome incorporates its genome into the chromosome of the host.

Can anyone help me with Genetics? I have some problems and answers and need them explained to me. Here are some of the questions and answers: 1. Assume that a dihybrid cross is made in which the genes' loci are autosomal, independantly assorting, and incompletely dominant. How...

Child psychology
Studies on the development of sexual orientation highlight the importance of A.genetics B. environment C. prenatal hormones D. multiple factors I said A the enviroment, Now thinking its D

The genome of Elradicus hypotheticus consists of 3 x 105 bp of B-DNA. a. How many turns are present in the double-helix? b. What is the length of the DNA in μm?

Genetics/Di hybrid Cross
Can someone show me how to set up this dihybrid cross? The genotypes of the two parents are RRLL' x RWL'L'. The " ' " meaning "prime."

1.Identify a typical developmental milestone for a person at a specific stage and explain how achievement of this milestone might be impacted by genetics and environment.

If a green eyes girl whose father is green eyeid marries a brown eye boy then what genotype the nxt generTION has

If a green eyes girl whose father is green eyeid marries a brown eye boy then what genotype the nxt generTION has

What are three sources of emobroyonic stem cells and how are they obtained from each? This is what I have so far: 1. Blasocyst of an embyro 2. Embilical cord of a baby 3. ? I don't understand how to explain how to obtain them. Don't you just remove them?

School advice please
What medical research field is in more demand? If I want to get a masters, what would you recommend me taking in undergrad between physiology, biochemistry, genetics, neuroscience or biotechnology?

i have a diploid cell with 3 pairs of homologous chromosomes A1,A2,B1,B2,C1,C2 with no crossing over. will my daughter cells after mitosis just be [A1,B1,C1] and [A2,B2,C2] or will there be a mix between the 1's and 2's creating more varieties?

A 50 year old male who is not overweight and has normal blood cholesterol levels suffers a heart attack. Propose a possible explanation i think the answer would be genetics...

______________ means that neither gene in a gene pair (genotype) masks the other. As a result, the traits carried by the 2 genes appear to be blended.

starting with 1000 copies of a template, 35 cycles of PCR were performed. What is the theoretical yield of copies of double stranded product of this amplification reaction?

Phenylketonuria is a metabolic disease of humans that results from an autosomal recessive gene. If the frequency of phenylketonurics in the population is 9/10,000, what is the probability that two normal individuals will produce a diseased child?


child psychology
The ability to solve abstact problems such as those found in algebra and higher mathematics is influenced by devdlopment and A. genetics B. societal factors C. health D. cognitive style

I need help finding a scientific journal on either one of these topics and talk about science environment technology and society, how this research contributed. -Genetics -Plants -Evolution -Diversity

Describe the inheritance and expression of cystic fibrosis, Tay-Sachs disease and sickle-cell anemia. I didn't understand what the question meant by "expression." Please help!

intro to psychology
Genetics and what we inherit from our biological parents play a significant role in our intelligence level. In fact, researchers have found that:

Science (Genetics)
How many males in America have brown eyes, green eyes, and/or blue eyes?

I have a quiz on genetics on friday in AP Biology and I would like some sites with good ap biology questions on them. I don't know any of them which I could go to.

how does the existence of cells, organelles, cellular reproduction, natural selection, DNA replication, transcription, translation, heredity, genetics, mutations, and taxonomy provide evidence that supports the theory of evolution?

How is personality developed? What roles do genetics and environment play in personality development? How do experiences influence personality? How is a person motivated?

population genetics
In a population where 8% of the men are red-green colour blind, what are the expected proportions of genotypes for the males and females? (Assume the trait does not affect survival or fertility.)

Recombination frequencies a. arise from completely random genetic exchange. b. are the same for all genes. c. decrease with distance. d. are the same for cis and trans heterozygotes.

How do the nucleotides affect the DNA? ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ This question had two parts but I already the the first part and half of the second, so could you help me with this last part? Thanks in advanced, Derpy Pegasus

  1. Pages:
  2. 1
  3. 2
  4. 3
  5. 4
  6. Next>>

Post a New Question