Thursday
May 23, 2013

Search: DNA-Repeats, strands

Number of results: 1,151

DNA-Repeats, strands
If one strand of a segment of double-stranded DNA is tandemly repeating, the complementary strand will consist of interspersed repeats, tandem repeats, same sequence in reverse order, or not enough info to decide?
Wednesday, October 4, 2006 at 6:29pm by Melanie Sims

Biology
Hi Dannie, 1. In order for a cell to reproduce it must copy its DNA to pass on its genetic information. 2.DNA replication is the process of duplicating the DNA to make 2 identical copies. 3.The first step of DNA replication is the separation of the 2 DNA strands.
Thursday, November 8, 2007 at 8:39pm by Mercedes

Biology
Kay so these are the strands of DNA 5' C C A G T A G T T 3' 3' G G T C A T C A A 5' Let's say the DNA molecule above were the parent strand of DNA. when the strands are split for replication, which strand would be the template for the leading strand? And ...
Sunday, February 20, 2011 at 8:03pm by Melanie

DNA, strand, complementary
If one strand of a segment of double-stranded DNA is tandemly repeating, the complementary strand will consist of interspersed repeats, tandem repeats, same sequence in reverse order, or not enough info to decide? anyone have any ideas, tips? it is ... a|T C|G
Wednesday, October 4, 2006 at 1:11pm by Melanie Sims

science- DNA
Of all possible DNA nucleotide sequences, what sequence of base pairs would dissociate most easily into single strands if the DNA duplex were heated gently?
Thursday, August 16, 2007 at 6:13pm by manny

science
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A or B. A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the correct ...
Sunday, November 20, 2011 at 6:57pm by jake

Biology
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A, am I right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...
Monday, November 21, 2011 at 6:31pm by jake

science
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A, am I right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...
Monday, November 21, 2011 at 6:30pm by jake

Science-important!
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A or B. A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the correct ...
Monday, November 21, 2011 at 3:44pm by jake

BIOLOGY
WHEN A DNA MOLECULE IS COPIED TO MAKE ANOTHER DNA MOLECULE, WHICH STATEMENT BEST DESCRIBES THE RESULTING STRANDS? A. ONE DOUBLE STRANDED DNA MOLECULE IS THE ORIGINAL AND THE OTHER A NEW COPY B. BOTH RESULTING STRANDS ARE ENTIRELY MADE OF NEW DNA BASED ON THE INFORMATION IN AN ...
Monday, October 20, 2008 at 8:08pm by JACK

dna strands/sequences
The restriction enzyme EcoR1 recognizes the DNA sequence GAATTC. Which DNA strands will be cut by EcoR1? I. TTCAGGAATTCGGAAACC AAGTCCTTAAGCCTTTGG II. TGAATCGAACCTG ACTTAGCTTGGAC III. TTAAGCGGCCGAATTCAGTCCA AATTCGCCCGCTTAAGTCAGGT IV. CAGTAGGATTTCTGTGTC GTCATCCTAAAGACACAG I and ...
Sunday, October 22, 2006 at 10:57pm by notasciencegal

Science
mismatch error to be repaired? Which is the best answer, I think it's A. Can someone who know's science tell me if I am right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of ...
Monday, November 21, 2011 at 4:45pm by jake

Science
Does anyone have any suggestions on where I might find the answers to my question? I have tried several different ways, but have not been successful. I think if I find the first one, I will find the others. If you have two strands of DNA, how many new DNA molecules will form ...
Sunday, April 13, 2008 at 8:33pm by Kally

Biology-Is my answer correct
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A, am I right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...
Monday, November 21, 2011 at 7:07pm by jake

Biology
14. The major components of a DNA molecular subunit are a. a chromosome, deoxyribose, and double helix b. a five-carbon sugar, phosphate group, and a nitrogen-containing base c. adenine, guanine, cytosine, and thymine d. all of the above D 16. During DNA replication, all of ...
Wednesday, February 3, 2010 at 6:03pm by mysterychicken

Science
After replicated a DNA molecule with two strands three times, how many molecules of DNA are formed? Is eight the correct answer?
Monday, April 14, 2008 at 8:33pm by Kally

Biology
14. The major components of a DNA molecular subunit are a. a chromosome, deoxyribose, and double helix b. a five-carbon sugar, phosphate group, and a nitrogen-containing base c. adenine, guanine, cytosine, and thymine d. all of the above D? 16. During DNA replication, all of ...
Wednesday, February 3, 2010 at 8:11pm by mysterychicken

biology
DNA is double strand, during transcription, they (the parents or original strands) separate into two single strands. Then the new strand will attach to each of the parent strand and form a new DNA molecule and because this new molecule consist half the parent and half the new ...
Monday, January 28, 2008 at 2:41pm by jAKE1214

Psychology
Which of the following statements describes the relationship between genes, chromosomes, and DNA? a. Genes, the basic unit of heredity, are located on chromosomes, which consist of strands of DNA b. Genes are composed of and DNA c. Chromosomes, the basic unit of heredity, ...
Monday, October 3, 2011 at 9:50pm by bj

psychology
Which one of the following statements describe the relationship between genes,chormosomes and DNA? A genes,the basic unit of heredity,are located on chromosomes,which consist of strands of DNA B genes are composed of chromosomes and Dna C chromosomes,tha basic unit of heredity...
Wednesday, September 16, 2009 at 2:48pm by VEDRANA

psychology
Which one of the following statements describe the relationship between genes,chormosomes and DNA? A genes,the basic unit of heredity,are located on chromosomes,which consist of strands of DNA B genes are composed of chromosomes and Dna C chromosomes,tha basic unit of heredity...
Wednesday, September 16, 2009 at 2:21pm by 888

Genes
Which one of the following statements describes the relationship between genes, chromosomes and DNA a) genes, the basic unit of heredity, are located on chromosomes, which consist of strands of DNA b) genes are composed of chromosome and DNA C) chromosomes the basic unit if ...
Sunday, August 22, 2010 at 9:32pm by Rena

psychology
Which one of the following statements describes the relationship between genes, chromosomes, and DNA? a. Genes, the basic unit of heredity, are located on chromosomes, which consist of strands of DNA.b. Genes are composed of chromosomes and DNA. c. Chromosomes, the basic unit ...
Friday, September 30, 2011 at 9:00am by bj

science
Of all possible DNA nucleotide sequences, what sequence of base pairs would dissociate most easily into single strands if the DNA duplex were heated gently?
Sunday, August 5, 2007 at 6:55pm by H.P.

chemistry
What types of linkage joins the nucleotides a) within a single DNA strand and b) between two single DNA strands?
Wednesday, May 7, 2008 at 10:43pm by Mable

biology
why is DNA semi-conservative? does it have something to do with two new strands are formed using the two molecules from the original DNA
Monday, January 28, 2008 at 2:41pm by sam

biology
i have some notes but before christmas break was here i had surgery so i didn't get to finish my notes in class and i don't understand much of my work so heres part of my notes: DNA and RNA Differences: #of strands for DNA? RNA? sugar DNA? RNA? Base that binds with ...
Monday, December 31, 2007 at 5:08pm by alex

biology
1.How many strands of mRNA are transcribed from the two "unzipped" strandsof DNA? 2.What are the three parts of an RNA nucleotide? 3.How does base pairing differ in RNA and DNA? 4.What is the function of mRNA? 5. What is a codon?
Monday, December 31, 2007 at 4:38pm by alex

science
Assume that the hereditary information carried in genes and DNA is responsible many differences observed in humans and other living things. How could just four different bases in DNA strands be responsible for the almost endless variety found in nature?
Tuesday, December 4, 2012 at 6:38pm by tammy

science
A segment of double-stranded DNA contains 31% Adenine (A) bases. a. What are the percentages of the other three bases in the DNA segment? (Count bases on both strands.) C: T: G:
Wednesday, September 28, 2011 at 7:02pm by Ellen

Science
I did your corrections. I just wanted to know if all the sentences are correct from a scientific point of view. Thank you. 1) DNA contains instructions which decide which proteins a cell will make and consequently determines the whole chemistry of the cell. 2) DNA is found in ...
Monday, May 23, 2011 at 3:25pm by Henry1

science
what is the number of strands in dna and rna?
Tuesday, February 24, 2009 at 8:41pm by Tammy

English
I'd like you to check these sentences grammatically. I also would like you to see if the terminology I used is correct. Help me improve my paragraph, please. 1)DNA contains instructions which decide which proteins a cell will make and consequently determines the whole ...
Monday, May 23, 2011 at 10:05am by Henry1

bio
o What are some of the benefits of squeezing so much data into virtually every cell in the body? o Why did humans not evolve with one central repository of DNA rather than having it replicated throughout the body? o Assume that the hereditary information carried in genes and ...
Tuesday, June 22, 2010 at 7:52pm by Anonymous

bio
DNA replications occurs when a cell is going to divide. Before replication can occur, the length of the DNA double helix about to be copied must be unwound. In addition, the two strands must be separated, much like the two sides of a zipper.
Sunday, November 25, 2007 at 6:02pm by Fabian

Biology
Also: 15. Which of the following is NOT true about DNA replication? a. It must occue before a cell can divide b. Two complementary strands are duplicated c. The double strand unwinds and unzips while it is being duplicated d. The process is catalyzed by enzymes called DNA ...
Friday, January 22, 2010 at 5:36pm by mysterychicken

Biology
What are some of the benefits of squeezing so much data into virtually every cell in the body? Why did humans not evolve with one central repository of DNA rather than having it replicated throughout the body? Assume that the hereditary information carried in genes and DNA is ...
Sunday, November 25, 2007 at 7:11pm by faye

biology
When does DNA synthesis occur? What is meant by leading and lagging strands?
Thursday, November 1, 2007 at 8:03pm by kelly

biology
1. What are the three parts that make up a nucleotide? 2. What is the sugar found in DNA? 3. What are the four different bases found in DNA nucleotides? 4. What two parts make up the sides of the DNA “ladder”? 5. What holds the sugars and the phosphates together? 6...
Sunday, February 24, 2008 at 1:11am by Anonymous

Science
Hi my textbook is not helping me at all, any links or ideas would be appreciated! What are some of the benefits of squeezing so much data into virtually every cell in the body? Why did we not evolve with one central repository of DNA rather than having it replicated throughout...
Sunday, November 25, 2007 at 7:11pm by Michelle

Science help please!!!!!!!
Hi my textbook is not helping me at all, any links or ideas would be appreciated! What are some of the benefits of squeezing so much data into virtually every cell in the body? Why did we not evolve with one central repository of DNA rather than having it replicated throughout...
Sunday, November 25, 2007 at 9:55pm by Michelle

Science quick question
Is this right?? How do the structures of nucleotides attach to the old dna strands? Matching C with G and A with T?
Wednesday, December 2, 2009 at 4:50pm by Lisa

biology
The backbone of the DNA strand is made from alternating phosphate and sugar residues.The sugar in DNA is 2-deoxyribose, which is a pentose (five-carbon) sugar. The sugars are joined together by phosphate groups that form phosphodiester bonds between the third and fifth carbon ...
Wednesday, February 27, 2008 at 10:10pm by Josh

biology
I am absolutly 100% biology stupid... I dont understand it, it is like a foriegn language to me... this is my questions. What are some of the benefits of squeezing so much data into virtually every cell in the body? · Why did humans not evolve with one central ...
Tuesday, June 24, 2008 at 9:45pm by Hope

biology
In DNA, I know that hydrogen bond connects the nucleotides of each strand, but what type of bond holds the two strands together? is it covalent?
Wednesday, February 27, 2008 at 10:10pm by Anonymous

math problem-
Bacteria grow in a nutrient solution at a rate proportional to the amount present. Initially, there are 250 strands of the bacteria in the solution which grows to 800 strands after seven hours. Find the time needed for the bacteria to grow to 1600 strands.
Saturday, May 12, 2012 at 5:15am by gwapa

science
for an example a strand of DNA could be GAT ACG TAG CAT CAA GGA GAC CCC TTA and match up the strands but remember no thymine in RNA it's only urical
Monday, December 14, 2009 at 9:05pm by christina

Biology
They are conserved sequences, and they both bind proteins to initiate the synthesis of a strand. However, the strands that they initiate synthesis of are different, as well as the proteins that they bind. DNA polymerase binds at the Replication Origin and initiates the copying...
Sunday, February 10, 2013 at 10:34pm by Devron

biology
1. Which of the following statements does not describe a difference between the DNA of prokaryotes and the DNA of eukaryotes ? a.prokaryotic DNA is shorter and less complex than eurkaryotic DNA b. Prokaryotic DNA chains have two nucleotides, eukaroyotic DNA has four. c. ...
Wednesday, May 1, 2013 at 8:28pm by Sven

Biology
In the final step of DNA extraction from E. Coli bacteria, we used ethanol so that the DNA would precipitate. Why is it that DNA precipitates in ethanol, and not in water? Both of them are polar solvents, and so is DNA. So why doesn't water make DNA precipitate?
Tuesday, November 11, 2008 at 6:02am by Christiaan

bio
1. Try some of the following links: http://search.yahoo.com/search?fr=mcafee&p=benefits+of+squeezing+so+much+data+into+every+cell 2. Try here: http://search.yahoo.com/search?fr=mcafee&p=why+h+umans+did+not+evolve+with+1+central+repository+of+DNA 3. Here: http://search....
Tuesday, June 22, 2010 at 7:52pm by SraJMcGin

SCIENCE
Please use lower-case letters. In computer language, capital letters (or upper-case letters) are considered as impolite as shouting. The reason for us is that it is more difficult to read; therefore some volunteer teachers will simply bypass your request. Try some of the ...
Friday, December 9, 2011 at 10:30am by SraJMcGin

Physics
In the figure below, a spider is resting after starting to spin its web. The gravitational force on the spider is 0.167 N on the junction of the three strands of silk. The junction is supported by different tension forces in the two strands above it so that the resultant force...
Wednesday, September 5, 2012 at 4:03pm by Nathan

Biology
17. When errors in nucleotide sequencing occur, a. DNA polymerases replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the DNA molecule d. DNA ...
Monday, February 8, 2010 at 5:32pm by mysterychicken

Biology
17. When errors in nucleotide sequencing occur, a. DNA polymerases replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the DNA molecule d. DNA ...
Monday, February 8, 2010 at 12:12pm by mysterychicken

bio
Supercoiling of DNA can occur (choose all that apply): A. when double stranded DNA is overwound B. when double stranded DNA is underwound C. when double stranded DNA is heated above it's Tm D. when DNA is treated with nucleases and Generally, cellular DNA is: A. Slightly ...
Monday, April 4, 2011 at 8:16pm by Yoo

biology
When do strands of DNA form chromoshomes? What is a replicated chromosome? How does this differ from a chromosome pair? Is a cell containing replicated chromosomes haploid, diploid, or neither? Why? and Why is anaphase unique in terms of chromosome number?
Saturday, November 28, 2009 at 8:38pm by Anonymous

bio
Supercoiling of DNA can occur (choose all that apply): A. when double stranded DNA is overwound B. when double stranded DNA is underwound C. when double stranded DNA is heated above it's Tm D. when DNA is treated with nucleases and Generally, cellular DNA is: A. Slightly ...
Monday, April 4, 2011 at 6:16pm by Yoo

geography
Thank you for using the Jiskha Homework Help Forum. Well, I'd be confused too! Is it possible the "tree" strands should be "three" strands? Then it means there is a physical, human and environmental side to geography. Sra
Monday, September 8, 2008 at 1:35pm by SraJMcGin

Science
The significance of specific base pairing in DNA is that A) it stabilizes the sugar molecule B) it provides a method for making exact copies of DNA C) it prevents errors in DNA replication D)protein copies can be be made directly from the DNA I'm pretty sure the answer is ...
Saturday, November 19, 2011 at 8:04pm by jake

DNA &RNA
For similarities, I would say that they both have hydrogen bonds. . . DNA is double stranded whereas RNA is single stranded. Two helices for DNA but one helix for RNA . . . RNA comes from the master plan blueprint called DNA. . . . RNA comes in messenger and transfer varieties...
Thursday, February 26, 2009 at 7:25pm by Brandon

Recombinant DNA
When you digest Vibrio DNA with Sal1, wh do you get mostly large DNA fragments?
Sunday, July 11, 2010 at 12:06am by Kim

Biology/DNA
When doing a DNA extraction, what advantages does a TE buffer provide to DNA that water cannot?
Wednesday, October 20, 2010 at 1:15am by Natalie

Biology Lab Banana DNA
Mush the bananas to release DNA. Water dissolved the DNA (it is an acid).
Tuesday, April 1, 2008 at 7:53pm by bobpursley

Physics
Stretching DNA. With its double-helix structure, DNA is coiled like a spring. A biophysicist grabs the ends of a DNA strand with optical tweezers and stretches it 26µm producing 1.2pN- tension in the strand. What's the DNA's spring constant?
Wednesday, October 12, 2011 at 5:06pm by Eman

Biology- DNA
What is needed to synthesize DNA? -a DNA strand -a primer and is that it?
Monday, February 7, 2011 at 11:20pm by Allie

living environment
Is that the exact language used in the original question? What are "two pieces of DNA"? Does it mean the two polynucleotide strands? But they are joined together (into a double helix) all the time, except for short segments at a time that separate during replication ...
Thursday, May 7, 2009 at 8:13pm by RickP

biology
The fact that they both have DNA is a similarity but the DNA does actually differ in that like Amy said above and that prokaryotic DNA is linear and eukaryotic DNA is typically circular wrapped around histone proteins. And prokaryotic cells do not have organelles in general, ...
Wednesday, October 19, 2011 at 8:06pm by ....

Science
what does DNA stand for? What is a gene? Where in the cell are chromosomes located? what two scientists established the structure of DNA? DNA is sometimes descrived as twisted ladder. What is this shape called? What forms the backbone of DNA? What forms the rungs of the ladder...
Thursday, March 3, 2011 at 4:50pm by brxce

science
There are about 300,000,000 US citizens. If we wanted to assign each person a unique identifier, using DNA sequences, how long a DNA sequence would we need? (Here’s another way of phrasing the question: How many bases of DNA are required for there to be at least 300 ...
Wednesday, September 28, 2011 at 7:01pm by Ellen

10th grade Living Environment
helicase unwinds the dna so that the dna can be replicated the polymerase "reads" an intact DNA strand as a template and uses it to synthesize the new strand.
Tuesday, March 31, 2009 at 6:50pm by betty

Biology
1. How many base pairs are in a full turn or twist of a DNA molecule? 2. Name the complementary base pairs on DNA. A-T; G-C are the pairs, you name them. there are 10 1/2 base pairs for a full twist in DNA How does the nucleotide sequence in one chain of DNA compare with the ...
Tuesday, January 9, 2007 at 3:41pm by Becky

BIOLOGY
1.What is the function of DNA? 2.Name 3 parts of DNA molecule 3.Describe the shape of DNA molecule
Wednesday, October 7, 2009 at 9:18pm by racheal

science-important!
I really need to make sure this is correct for tommorow please help! The significance of specific base pairing in DNA is that A) it stabilizes the sugar molecule B) it provides a method for making exact copies of DNA C) it prevents errors in DNA replication D)protein copies ...
Saturday, November 19, 2011 at 9:50pm by jake

science-important!
I really need to make sure this is correct for tommorow please help! The significance of specific base pairing in DNA is that A) it stabilizes the sugar molecule B) it provides a method for making exact copies of DNA C) it prevents errors in DNA replication D)protein copies ...
Saturday, November 19, 2011 at 9:50pm by jake

Biology DNA
What are the components of DNA and how is the backbone of a single strand of DNA constructed? I put the components as nitrogenous base, deoxyribose molecule, and a phosphate group...I don't know the second part of the question :/
Wednesday, March 20, 2013 at 10:37pm by Anonymous

biology
DNA codes for mRNA, which is then translated into polypeptides,which are strands of amino acids. The DNA sequence below codes for the following amino acids: methionine-valine-glycine-alanine-alanine-serine TAC CAA CCA CGC CGC UCA What effect would the addition of the ...
Monday, December 31, 2007 at 10:46pm by stacey

physics
The physics of the DNA molecule. The two strands of the DNA molecule are held together by electrostatic forces. There are four bases which make up the DNA molecule, thymine (T), adenine (A), cytosine (C), and guanine (G). In two of the bases, thymine and adenine, an oxide ion ...
Thursday, April 28, 2011 at 12:55am by aly

BIOLOGY-DNA FINGERPRINTING
Okay soo i'm confused on DNA fingerprinting, i know what it is and everything but why do they call it DNA fingerprinting when a fingerprint is only a mark left by the person?
Wednesday, February 24, 2010 at 7:38am by SAMMEHH

biology
During DNA replication, DNA Polymerase matches up the pairs of nitrogenous bases, prepared by the RNA primer (made by the enzyme RNA Primase)to create a new segment of DNA. They are matched to the bases on the parent strand. This occurs on both the leading strand and the ...
Thursday, October 28, 2010 at 1:23am by TheQuestion

Biology
If bird DNA is more similar to crocodile DNA than turtle DNA is to crocodile DNA, then... A)birds should be included amoung reptiles B)turtles and birds should be excluded from the reptiles C)the reptiles should be replaced by several new classes D)each of the above represents...
Tuesday, February 8, 2011 at 10:33pm by Carly

Biology
1. Why must DNA be able to make copies of itself? 2. Define DNA replication? 3. What is the first step that must occur in DNA replication?
Thursday, November 8, 2007 at 8:39pm by Dannie

biology
talk about the ethanol dissolving the phospholipid bi layer of the membrane, and the protein as the tertiary structure is ruptured. Also reliability- didnt do any repeats etc, you can use repeats to make an average so it is more accurate. do your results support the hypothesis...
Tuesday, January 31, 2012 at 6:08pm by hassan

biology
How is recombinant DNA technology used today? I have to use bacterial chromosomal or genomic DNA,plasmid,restriction enzyme, vector, sticky end, transformation, DNA ligase, gene cloning,restriction fragment, and restriction site in the answer.
Monday, June 30, 2008 at 4:42pm by H

Bio...DNA
Can anyone explain the relationship between the structure of DNA , protein structure and phenotype of an organism? Also, what is the role of DNA in protein synthesis? I will give you a little hint. The DNA makes the RNA. The RNA makes the proteins by amino acid building blocks...
Sunday, May 20, 2007 at 11:54am by Pet

Biology
The polymerase chain reaction (PCR) is useful for: A) making many copies of a small amount of DNA B) creating recombinant plasmids C) analyzing a person’s fingerprints D) cutting DNA into many small pieces E) allowing restriction enzymes to cut DNA at palindromes I can&#...
Friday, November 12, 2010 at 2:21pm by stelle

Chemistry-Just checking my answer
For each template DNA, I prepared a second PCR reaction that includes "GMO" primers. Assume that all three foods had usable plant DNA. Which template DNA (non-GMO,GMO,test food) would you expect to show successful amplification of the "GMO" target sequence...
Sunday, December 2, 2012 at 4:13pm by Deb

Science
Can someone tell me if I answered my question correctly? During the cell cycle when does DNA replication take place? During interphase and the DNA synthesis separates the eukaryotic cells into four phases. Gap 1 phase is the intervals between mitosis and initiation of DNA ...
Thursday, April 10, 2008 at 5:01pm by Kally

Biology
17. When errors in nucleotide sequencing occur, a. DNA polymerase replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the DNA molecule d. DNA ...
Thursday, February 4, 2010 at 8:21pm by mysterychicken

Biology
17. When errors in nucleotide sequencing occur, a. DNA polymerase replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the DNA molecule d. DNA ...
Thursday, February 4, 2010 at 4:56pm by mysterychicken

Biology DNA
can somebody please explain the relationship between the structure of DNA, protein structure and the phenotype of an organism and the relationship between DNA chromatin and chromosome
Saturday, May 17, 2008 at 6:21pm by Marva

how do protons move during electrophoresis
During electrophoresis, protons move in the same direction as DNA. do not move at all. move in the opposite direction as DNA. move randomly. I am thinking they move in the same direction as DNA or am I wrong? DNA travels in accordance with its principal charge, negative, the ...
Sunday, October 22, 2006 at 4:45pm by Kellie Jo

Physics
The two strands of the helix-shaped DNA molecule are held together by electrostatic forces as shown in the Figure 16-44 in the textbook. Assume that the net average charge (due to electron sharing) indicated on H and N atoms is 0.2e and on the indicated C and O atoms is 0.4e. ...
Monday, February 4, 2013 at 3:59pm by Adam

biology
A common first step in the making of a DNA library is to obtain DNA from many of your chosen organisms and cut this source DNA with a restriction enzyme. It is likely that some genes will contain sites for the chosen restriction enzyme, and in this case, your DNA library will ...
Thursday, May 2, 2013 at 2:49am by Anonymous

Genetics
A viral DNA is analyzed and found to have the following base composition, in mole percent: A = 32, G = 16, T = 40, C = 12. What can you immediately conclude about this DNA? a stretch of double stranded DNA contains 1000 base pairs and its base composition is 58 % (G + C). How ...
Thursday, September 17, 2009 at 12:14pm by Anonymous

English/General
I'm not clear on what you're asking. If you are listing three course names, here are my suggestions: What Every Law Enforcement Officer Should Know About DNA Evidence: First Responding Officers course What Every Law Enforcement Officer Should Know About DNA Evidence: ...
Tuesday, January 29, 2008 at 3:05am by Writeacher

10th Grade Science
-What contains DNA? -Where is DNA found?
Thursday, May 5, 2011 at 8:15am by Crissy XD

DNA
look up DNA or RNA for stop, start functions.
Wednesday, September 29, 2010 at 4:00pm by bobpursley

science
how does the structure of DNA help account for the way in wich DNA copies itself
Sunday, January 4, 2009 at 11:41pm by tommy

Grammar
Frankly, one strand or two strands and viscosity have nothing to do with each other. Viscosity is a macroscopic characteristic (ie , trillion trillion trillion trillion molecules), and a strand is microscopic (in ones or twos). So a single strand cannot have viscosity. I would...
Saturday, January 31, 2009 at 7:51pm by bobpursley

Pages: 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | Next>>

For Further Reading

Search
Members
Community