Thursday
August 21, 2014

Search: DNA-Repeats, strands

Number of results: 886

DNA-Repeats, strands
If one strand of a segment of double-stranded DNA is tandemly repeating, the complementary strand will consist of interspersed repeats, tandem repeats, same sequence in reverse order, or not enough info to decide?
October 4, 2006 by Melanie Sims

dna strands/sequences
The restriction enzyme EcoR1 recognizes the DNA sequence GAATTC. Which DNA strands will be cut by EcoR1? I. TTCAGGAATTCGGAAACC AAGTCCTTAAGCCTTTGG II. TGAATCGAACCTG ACTTAGCTTGGAC III. TTAAGCGGCCGAATTCAGTCCA AATTCGCCCGCTTAAGTCAGGT IV. CAGTAGGATTTCTGTGTC GTCATCCTAAAGACACAG I and ...
October 22, 2006 by notasciencegal

Biology
Kay so these are the strands of DNA 5' C C A G T A G T T 3' 3' G G T C A T C A A 5' Let's say the DNA molecule above were the parent strand of DNA. when the strands are split for replication, which strand would be the template for the leading strand? And can you also please ...
February 20, 2011 by Melanie

Biology
In DNA fingerprinting, the DNA probe that is used is ______to the DNA sequence of the repeats in the sample? im guessing amplify????
November 12, 2013 by vickie

Science
In DNA fingerprinting, the DNA probe that is used is ______to the DNA sequence of the repeats in the sample? im guessing amplify????
November 12, 2013 by vickie

DNA, strand, complementary
If one strand of a segment of double-stranded DNA is tandemly repeating, the complementary strand will consist of interspersed repeats, tandem repeats, same sequence in reverse order, or not enough info to decide? anyone have any ideas, tips? it is ... a|T C|G
October 4, 2006 by Melanie Sims

science- DNA
Of all possible DNA nucleotide sequences, what sequence of base pairs would dissociate most easily into single strands if the DNA duplex were heated gently?
August 16, 2007 by manny

science
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A or B. A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the correct DNA ...
November 20, 2011 by jake

BIOLOGY
WHEN A DNA MOLECULE IS COPIED TO MAKE ANOTHER DNA MOLECULE, WHICH STATEMENT BEST DESCRIBES THE RESULTING STRANDS? A. ONE DOUBLE STRANDED DNA MOLECULE IS THE ORIGINAL AND THE OTHER A NEW COPY B. BOTH RESULTING STRANDS ARE ENTIRELY MADE OF NEW DNA BASED ON THE INFORMATION IN AN ...
October 20, 2008 by JACK

Science-important!
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A or B. A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the correct DNA ...
November 21, 2011 by jake

science
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A, am I right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...
November 21, 2011 by jake

Biology
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A, am I right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...
November 21, 2011 by jake

Science
mismatch error to be repaired? Which is the best answer, I think it's A. Can someone who know's science tell me if I am right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...
November 21, 2011 by jake

Biology
14. The major components of a DNA molecular subunit are a. a chromosome, deoxyribose, and double helix b. a five-carbon sugar, phosphate group, and a nitrogen-containing base c. adenine, guanine, cytosine, and thymine d. all of the above D 16. During DNA replication, all of ...
February 3, 2010 by mysterychicken

Science
Does anyone have any suggestions on where I might find the answers to my question? I have tried several different ways, but have not been successful. I think if I find the first one, I will find the others. If you have two strands of DNA, how many new DNA molecules will form ...
April 13, 2008 by Kally

Biology
14. The major components of a DNA molecular subunit are a. a chromosome, deoxyribose, and double helix b. a five-carbon sugar, phosphate group, and a nitrogen-containing base c. adenine, guanine, cytosine, and thymine d. all of the above D? 16. During DNA replication, all of ...
February 3, 2010 by mysterychicken

Biology-Is my answer correct
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A, am I right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...
November 21, 2011 by jake

Science
After replicated a DNA molecule with two strands three times, how many molecules of DNA are formed? Is eight the correct answer?
April 14, 2008 by Kally

psychology
Which one of the following statements describe the relationship between genes,chormosomes and DNA? A genes,the basic unit of heredity,are located on chromosomes,which consist of strands of DNA B genes are composed of chromosomes and Dna C chromosomes,tha basic unit of heredity...
September 16, 2009 by 888

psychology
Which one of the following statements describe the relationship between genes,chormosomes and DNA? A genes,the basic unit of heredity,are located on chromosomes,which consist of strands of DNA B genes are composed of chromosomes and Dna C chromosomes,tha basic unit of heredity...
September 16, 2009 by VEDRANA

Psychology
Which of the following statements describes the relationship between genes, chromosomes, and DNA? a. Genes, the basic unit of heredity, are located on chromosomes, which consist of strands of DNA b. Genes are composed of and DNA c. Chromosomes, the basic unit of heredity, ...
October 3, 2011 by bj

Genes
Which one of the following statements describes the relationship between genes, chromosomes and DNA a) genes, the basic unit of heredity, are located on chromosomes, which consist of strands of DNA b) genes are composed of chromosome and DNA C) chromosomes the basic unit if ...
August 22, 2010 by Rena

psychology
Which one of the following statements describes the relationship between genes, chromosomes, and DNA? a. Genes, the basic unit of heredity, are located on chromosomes, which consist of strands of DNA.b. Genes are composed of chromosomes and DNA. c. Chromosomes, the basic unit ...
September 30, 2011 by bj

science
Of all possible DNA nucleotide sequences, what sequence of base pairs would dissociate most easily into single strands if the DNA duplex were heated gently?
August 5, 2007 by H.P.

chemistry
What types of linkage joins the nucleotides a) within a single DNA strand and b) between two single DNA strands?
May 7, 2008 by Mable

biology
why is DNA semi-conservative? does it have something to do with two new strands are formed using the two molecules from the original DNA
January 28, 2008 by sam

biology
i have some notes but before christmas break was here i had surgery so i didn't get to finish my notes in class and i don't understand much of my work so heres part of my notes: DNA and RNA Differences: #of strands for DNA? RNA? sugar DNA? RNA? Base that binds with Adenine DNA...
December 31, 2007 by alex

biology
1. What are the three parts that make up a nucleotide? 2. What is the sugar found in DNA? 3. What are the four different bases found in DNA nucleotides? 4. What two parts make up the sides of the DNA “ladder”? 5. What holds the sugars and the phosphates together? 6. What ...
February 24, 2008 by Anonymous

science
Describe DNA replication in prokaryotes. Include the major steps for origins of replication, unwinding DNA, and synthesis of new strands. Include at least 1 simplified diagram.
April 8, 2014 by kharcuss

science
Describe DNA replication in prokaryotes. Include the major steps for origins of replication, unwinding DNA, and synthesis of new strands. Include at least 1 simplified diagram.
April 8, 2014 by steven

biology
1.How many strands of mRNA are transcribed from the two "unzipped" strandsof DNA? 2.What are the three parts of an RNA nucleotide? 3.How does base pairing differ in RNA and DNA? 4.What is the function of mRNA? 5. What is a codon?
December 31, 2007 by alex

science
Assume that the hereditary information carried in genes and DNA is responsible many differences observed in humans and other living things. How could just four different bases in DNA strands be responsible for the almost endless variety found in nature?
December 4, 2012 by tammy

Science
I did your corrections. I just wanted to know if all the sentences are correct from a scientific point of view. Thank you. 1) DNA contains instructions which decide which proteins a cell will make and consequently determines the whole chemistry of the cell. 2) DNA is found in ...
May 23, 2011 by Henry1

science
A segment of double-stranded DNA contains 31% Adenine (A) bases. a. What are the percentages of the other three bases in the DNA segment? (Count bases on both strands.) C: T: G:
September 28, 2011 by Ellen

science
what is the number of strands in dna and rna?
February 24, 2009 by Tammy

English
I'd like you to check these sentences grammatically. I also would like you to see if the terminology I used is correct. Help me improve my paragraph, please. 1)DNA contains instructions which decide which proteins a cell will make and consequently determines the whole ...
May 23, 2011 by Henry1

bio
o What are some of the benefits of squeezing so much data into virtually every cell in the body? o Why did humans not evolve with one central repository of DNA rather than having it replicated throughout the body? o Assume that the hereditary information carried in genes and ...
June 22, 2010 by Anonymous

biology
When does DNA synthesis occur? What is meant by leading and lagging strands?
November 1, 2007 by kelly

BIOLOGY
If a PCR product is 659 bp, how many D1S80 repeats are present in that DNA molecule?
April 22, 2014 by BIOLOGY

Science
Hi my textbook is not helping me at all, any links or ideas would be appreciated! What are some of the benefits of squeezing so much data into virtually every cell in the body? Why did we not evolve with one central repository of DNA rather than having it replicated throughout...
November 25, 2007 by Michelle

Science quick question
Is this right?? How do the structures of nucleotides attach to the old dna strands? Matching C with G and A with T?
December 2, 2009 by Lisa

Science help please!!!!!!!
Hi my textbook is not helping me at all, any links or ideas would be appreciated! What are some of the benefits of squeezing so much data into virtually every cell in the body? Why did we not evolve with one central repository of DNA rather than having it replicated throughout...
November 25, 2007 by Michelle

biology
I am absolutly 100% biology stupid... I dont understand it, it is like a foriegn language to me... this is my questions. What are some of the benefits of squeezing so much data into virtually every cell in the body? · Why did humans not evolve with one central repository of ...
June 24, 2008 by Hope

math problem-
Bacteria grow in a nutrient solution at a rate proportional to the amount present. Initially, there are 250 strands of the bacteria in the solution which grows to 800 strands after seven hours. Find the time needed for the bacteria to grow to 1600 strands.
May 12, 2012 by gwapa

biology
In DNA, I know that hydrogen bond connects the nucleotides of each strand, but what type of bond holds the two strands together? is it covalent?
February 27, 2008 by Anonymous

Biology
5. Dideoxynucleosides are employed in the course of the Sanger process of DNA sequencing. Dideocynucleosides are used because a) They stop the synthesis of DNA strands b) They are fluoresce c) They are radioactive d) They move quicly during gel electrophoresis e) They ...
May 8, 2014 by Deepa

biology
1. Which of the following statements does not describe a difference between the DNA of prokaryotes and the DNA of eukaryotes ? a.prokaryotic DNA is shorter and less complex than eurkaryotic DNA b. Prokaryotic DNA chains have two nucleotides, eukaroyotic DNA has four. c. ...
May 1, 2013 by Sven

Physics
In the figure below, a spider is resting after starting to spin its web. The gravitational force on the spider is 0.167 N on the junction of the three strands of silk. The junction is supported by different tension forces in the two strands above it so that the resultant force...
September 5, 2012 by Nathan

Biology
In the final step of DNA extraction from E. Coli bacteria, we used ethanol so that the DNA would precipitate. Why is it that DNA precipitates in ethanol, and not in water? Both of them are polar solvents, and so is DNA. So why doesn't water make DNA precipitate?
November 11, 2008 by Christiaan

Biology
17. When errors in nucleotide sequencing occur, a. DNA polymerases replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the DNA molecule d. DNA ...
February 8, 2010 by mysterychicken

Biology
17. When errors in nucleotide sequencing occur, a. DNA polymerases replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the DNA molecule d. DNA ...
February 8, 2010 by mysterychicken

biology
When do strands of DNA form chromoshomes? What is a replicated chromosome? How does this differ from a chromosome pair? Is a cell containing replicated chromosomes haploid, diploid, or neither? Why? and Why is anaphase unique in terms of chromosome number?
November 28, 2009 by Anonymous

bio
Supercoiling of DNA can occur (choose all that apply): A. when double stranded DNA is overwound B. when double stranded DNA is underwound C. when double stranded DNA is heated above it's Tm D. when DNA is treated with nucleases and Generally, cellular DNA is: A. Slightly ...
April 4, 2011 by Yoo

bio
Supercoiling of DNA can occur (choose all that apply): A. when double stranded DNA is overwound B. when double stranded DNA is underwound C. when double stranded DNA is heated above it's Tm D. when DNA is treated with nucleases and Generally, cellular DNA is: A. Slightly ...
April 4, 2011 by Yoo

Science
The significance of specific base pairing in DNA is that A) it stabilizes the sugar molecule B) it provides a method for making exact copies of DNA C) it prevents errors in DNA replication D)protein copies can be be made directly from the DNA I'm pretty sure the answer is D, ...
November 19, 2011 by jake

Physics
Stretching DNA. With its double-helix structure, DNA is coiled like a spring. A biophysicist grabs the ends of a DNA strand with optical tweezers and stretches it 26µm producing 1.2pN- tension in the strand. What's the DNA's spring constant?
October 12, 2011 by Eman

DNA
Do the two DNA double helices following DNA replication have the same, or a different, composition?
April 23, 2014 by Dee Anna

Recombinant DNA
When you digest Vibrio DNA with Sal1, wh do you get mostly large DNA fragments?
July 11, 2010 by Kim

Biology/DNA
When doing a DNA extraction, what advantages does a TE buffer provide to DNA that water cannot?
October 20, 2010 by Natalie

Biology- DNA
What is needed to synthesize DNA? -a DNA strand -a primer and is that it?
February 7, 2011 by Allie

Science
what does DNA stand for? What is a gene? Where in the cell are chromosomes located? what two scientists established the structure of DNA? DNA is sometimes descrived as twisted ladder. What is this shape called? What forms the backbone of DNA? What forms the rungs of the ladder...
March 3, 2011 by brxce

Biology PleaSE help!
Hello, this is my biology assignment. I filled the answer's but I just need your help to correct me if I'm wrong Thank you. 1) The discovery of restriction endonucleases was crucial to the development of recombinant DNA technology because these enzymes. a) always cut DNA at ...
May 8, 2014 by Deepa

bio please help Ms sue
DNA is copied by an enzyme called DNA (A) __________, and the process of copying DNA is called (B) __________. The two new double-stranded DNA molecules have one strand from the original DNA molecule and one strand from the freshly assembled strand of nucleotides. This is ...
May 26, 2014 by carrie

Biology
1. How many base pairs are in a full turn or twist of a DNA molecule? 2. Name the complementary base pairs on DNA. A-T; G-C are the pairs, you name them. there are 10 1/2 base pairs for a full twist in DNA How does the nucleotide sequence in one chain of DNA compare with the ...
January 9, 2007 by Becky

science
There are about 300,000,000 US citizens. If we wanted to assign each person a unique identifier, using DNA sequences, how long a DNA sequence would we need? (Here’s another way of phrasing the question: How many bases of DNA are required for there to be at least 300 million ...
September 28, 2011 by Ellen

Biology
Hello, this is my biology assignment. I filled the answer's but I just need your help to correct me if I'm wrong Thank you. 1) The discovery of restriction endonucleases was crucial to the development of recombinant DNA technology because these enzymes. a) always cut DNA at ...
May 8, 2014 by Deepa

Biology
For the DNA sequence given below, write the complementary DNA sequence that would compliment the double-strand DNA 3'--ATTGCTTACTTGCATGGTACCTCTAGCGTTTAGGC--5'
March 22, 2014 by Danielle

biology
DNA codes for mRNA, which is then translated into polypeptides,which are strands of amino acids. The DNA sequence below codes for the following amino acids: methionine-valine-glycine-alanine-alanine-serine TAC CAA CCA CGC CGC UCA What effect would the addition of the ...
December 31, 2007 by stacey

physics
The physics of the DNA molecule. The two strands of the DNA molecule are held together by electrostatic forces. There are four bases which make up the DNA molecule, thymine (T), adenine (A), cytosine (C), and guanine (G). In two of the bases, thymine and adenine, an oxide ion ...
April 28, 2011 by aly

science-important!
I really need to make sure this is correct for tommorow please help! The significance of specific base pairing in DNA is that A) it stabilizes the sugar molecule B) it provides a method for making exact copies of DNA C) it prevents errors in DNA replication D)protein copies ...
November 19, 2011 by jake

science-important!
I really need to make sure this is correct for tommorow please help! The significance of specific base pairing in DNA is that A) it stabilizes the sugar molecule B) it provides a method for making exact copies of DNA C) it prevents errors in DNA replication D)protein copies ...
November 19, 2011 by jake

Biology DNA
What are the components of DNA and how is the backbone of a single strand of DNA constructed? I put the components as nitrogenous base, deoxyribose molecule, and a phosphate group...I don't know the second part of the question :/
March 20, 2013 by Anonymous

BIOLOGY
1.What is the function of DNA? 2.Name 3 parts of DNA molecule 3.Describe the shape of DNA molecule
October 7, 2009 by racheal

BIOLOGY-DNA FINGERPRINTING
Okay soo i'm confused on DNA fingerprinting, i know what it is and everything but why do they call it DNA fingerprinting when a fingerprint is only a mark left by the person?
February 24, 2010 by SAMMEHH

Biology
If bird DNA is more similar to crocodile DNA than turtle DNA is to crocodile DNA, then... A)birds should be included amoung reptiles B)turtles and birds should be excluded from the reptiles C)the reptiles should be replaced by several new classes D)each of the above represents...
February 8, 2011 by Carly

Physics
The two strands of the helix-shaped DNA molecule are held together by electrostatic forces as shown in the Figure 16-44 in the textbook. Assume that the net average charge (due to electron sharing) indicated on H and N atoms is 0.2e and on the indicated C and O atoms is 0.4e. ...
February 4, 2013 by Adam

Bio...DNA
Can anyone explain the relationship between the structure of DNA , protein structure and phenotype of an organism? Also, what is the role of DNA in protein synthesis? I will give you a little hint. The DNA makes the RNA. The RNA makes the proteins by amino acid building blocks...
May 20, 2007 by Pet

Biology
1. Why must DNA be able to make copies of itself? 2. Define DNA replication? 3. What is the first step that must occur in DNA replication?
November 8, 2007 by Dannie

biology
How is recombinant DNA technology used today? I have to use bacterial chromosomal or genomic DNA,plasmid,restriction enzyme, vector, sticky end, transformation, DNA ligase, gene cloning,restriction fragment, and restriction site in the answer.
June 30, 2008 by H

Biology
For questions 1 and 2 use the table in Figure 12-3 to help you answer the question. Nitrogenous Bases Figure 12-3 1. The table in Figure 12-3 shows the results of measuring the percentages of the four bases in the DNA of several different organisms. Some of the values are ...
December 6, 2012 by Jessie

Biology
The polymerase chain reaction (PCR) is useful for: A) making many copies of a small amount of DNA B) creating recombinant plasmids C) analyzing a person’s fingerprints D) cutting DNA into many small pieces E) allowing restriction enzymes to cut DNA at palindromes I can't ...
November 12, 2010 by stelle

Chemistry-Just checking my answer
For each template DNA, I prepared a second PCR reaction that includes "GMO" primers. Assume that all three foods had usable plant DNA. Which template DNA (non-GMO,GMO,test food) would you expect to show successful amplification of the "GMO" target sequence? I said all three ...
December 2, 2012 by Deb

Science
Can someone tell me if I answered my question correctly? During the cell cycle when does DNA replication take place? During interphase and the DNA synthesis separates the eukaryotic cells into four phases. Gap 1 phase is the intervals between mitosis and initiation of DNA ...
April 10, 2008 by Kally

Biology
17. When errors in nucleotide sequencing occur, a. DNA polymerase replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the DNA molecule d. DNA ...
February 4, 2010 by mysterychicken

Biology
17. When errors in nucleotide sequencing occur, a. DNA polymerase replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the DNA molecule d. DNA ...
February 4, 2010 by mysterychicken

Genetics
A viral DNA is analyzed and found to have the following base composition, in mole percent: A = 32, G = 16, T = 40, C = 12. What can you immediately conclude about this DNA? a stretch of double stranded DNA contains 1000 base pairs and its base composition is 58 % (G + C). How ...
September 17, 2009 by Anonymous

how do protons move during electrophoresis
During electrophoresis, protons move in the same direction as DNA. do not move at all. move in the opposite direction as DNA. move randomly. I am thinking they move in the same direction as DNA or am I wrong? DNA travels in accordance with its principal charge, negative, the ...
October 22, 2006 by Kellie Jo

Biology DNA
can somebody please explain the relationship between the structure of DNA, protein structure and the phenotype of an organism and the relationship between DNA chromatin and chromosome
May 17, 2008 by Marva

biology
A common first step in the making of a DNA library is to obtain DNA from many of your chosen organisms and cut this source DNA with a restriction enzyme. It is likely that some genes will contain sites for the chosen restriction enzyme, and in this case, your DNA library will ...
May 2, 2013 by Anonymous

Biochemisty
The DNA alpha-helix structure has 566900 complete turns. The average molar mass of one base pair of nucleotides in DNA is approximately 469 g/mol. If the spacing between successive base pairs is about 0.69 nm, and a complete turn in the helical structure of DNA occurs every 6....
March 20, 2014 by Rin

science
How often would a restriction enzyme such as Not I, which has 8 nucleotides in its recognition sites 5’-GCGGCCGC-3’, cleave DNA on average? Would it cleave a species DNA more or less often if the DNA from that species were 70% A-T rich?
February 2, 2014 by Lindsey

Biology
A student claims the probability a human sperm will receive all chromatids of maternal origin is 50 %. Explain why she is wrong. Are the following true or false and support your answer: i. Red blood cells and nerve cells in adult humans are suitable for karyotyping (...
September 19, 2011 by Ashley

science
how does the structure of DNA help account for the way in wich DNA copies itself
January 4, 2009 by tommy

another bio ?
what direction along a DNA strand does DNA polymerase add base pairs
November 1, 2007 by kelly

Biology
what properties/features of DNA allow DNA to have uniformity and be a universal molecule?
March 18, 2009 by Aqsa

sci 230
Missing DNA? Do we have any cells with no DNA? What would they be like? What could they be used for?
April 16, 2009 by meshelle

Biology- DNA
why dna replication necessary to life? i think it because it carry genetic information?
February 20, 2012 by Shreya

science
(a) Investigators often remove blood from a crime scene in order to extract DNA for forensics. Although blood cells do contain nucleic acids, why would blood yield relatively less DNA than semen containing sperm cells? (b)What are some other uses for DNA extracted from a human...
September 8, 2012 by peanut

DNA &RNA
State two differences between DNA and RNA. we did not study this at all, so far I see that DNA has several million nucleotides, the smaller RNA only has several thousand of them. the second thing I noticed is that they both have a base,a five carbon sugar and a phosphate group...
February 26, 2009 by sport

BIOLOGY (DNA)
Why does DNA have the consistancy of thick syrup or mucus? because of all of the different substances
August 21, 2006 by Patrick

Pages: 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | Next>>

Search
Members