Thursday
July 24, 2014

Search: Chem/DNA

Number of results: 6,721

Biology
In the final step of DNA extraction from E. Coli bacteria, we used ethanol so that the DNA would precipitate. Why is it that DNA precipitates in ethanol, and not in water? Both of them are polar solvents, and so is DNA. So why doesn't water make DNA precipitate?
November 11, 2008 by Christiaan

science
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A or B. A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the correct DNA ...
November 20, 2011 by jake

Science-important!
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A or B. A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the correct DNA ...
November 21, 2011 by jake

science
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A, am I right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...
November 21, 2011 by jake

Biology
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A, am I right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...
November 21, 2011 by jake

Science
mismatch error to be repaired? Which is the best answer, I think it's A. Can someone who know's science tell me if I am right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...
November 21, 2011 by jake

bio
Supercoiling of DNA can occur (choose all that apply): A. when double stranded DNA is overwound B. when double stranded DNA is underwound C. when double stranded DNA is heated above it's Tm D. when DNA is treated with nucleases and Generally, cellular DNA is: A. Slightly ...
April 4, 2011 by Yoo

bio
Supercoiling of DNA can occur (choose all that apply): A. when double stranded DNA is overwound B. when double stranded DNA is underwound C. when double stranded DNA is heated above it's Tm D. when DNA is treated with nucleases and Generally, cellular DNA is: A. Slightly ...
April 4, 2011 by Yoo

Science
The significance of specific base pairing in DNA is that A) it stabilizes the sugar molecule B) it provides a method for making exact copies of DNA C) it prevents errors in DNA replication D)protein copies can be be made directly from the DNA I'm pretty sure the answer is D, ...
November 19, 2011 by jake

Physics
Stretching DNA. With its double-helix structure, DNA is coiled like a spring. A biophysicist grabs the ends of a DNA strand with optical tweezers and stretches it 26µm producing 1.2pN- tension in the strand. What's the DNA's spring constant?
October 12, 2011 by Eman

Biology-Is my answer correct
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A, am I right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...
November 21, 2011 by jake

DNA
Do the two DNA double helices following DNA replication have the same, or a different, composition?
April 23, 2014 by Dee Anna

Biology
In DNA fingerprinting, the DNA probe that is used is ______to the DNA sequence of the repeats in the sample? im guessing amplify????
November 12, 2013 by vickie

Science
In DNA fingerprinting, the DNA probe that is used is ______to the DNA sequence of the repeats in the sample? im guessing amplify????
November 12, 2013 by vickie

chem
Predict out of which of the following would a dialysis bag be permeable to? Potassium Ions= DNA= Sucrose= No? Starch =No? Sulfate Ion=yes Chloride Ion=yes Protein=No I'm not sure about potassium ions or DNA though.
April 18, 2012 by al

Recombinant DNA
When you digest Vibrio DNA with Sal1, wh do you get mostly large DNA fragments?
July 11, 2010 by Kim

Biology/DNA
When doing a DNA extraction, what advantages does a TE buffer provide to DNA that water cannot?
October 20, 2010 by Natalie

Biology- DNA
What is needed to synthesize DNA? -a DNA strand -a primer and is that it?
February 7, 2011 by Allie

Science
what does DNA stand for? What is a gene? Where in the cell are chromosomes located? what two scientists established the structure of DNA? DNA is sometimes descrived as twisted ladder. What is this shape called? What forms the backbone of DNA? What forms the rungs of the ladder...
March 3, 2011 by brxce

science- DNA
Of all possible DNA nucleotide sequences, what sequence of base pairs would dissociate most easily into single strands if the DNA duplex were heated gently?
August 16, 2007 by manny

Bio/CHEM
11. You need to make a 1:8 ratio of DNA of two DNA types A and B (A:B). Your total aliquot should be 2ng/26 ěL. For each of the following sets, calculate how much of each extract you should use and how much TE-4: a. Extract A: 2.5 ng/20 ěL, Extract B: 252.3 pg/ěL b. Extract A...
May 24, 2013 by Remy

bio please help Ms sue
DNA is copied by an enzyme called DNA (A) __________, and the process of copying DNA is called (B) __________. The two new double-stranded DNA molecules have one strand from the original DNA molecule and one strand from the freshly assembled strand of nucleotides. This is ...
May 26, 2014 by carrie

Biology
1. How many base pairs are in a full turn or twist of a DNA molecule? 2. Name the complementary base pairs on DNA. A-T; G-C are the pairs, you name them. there are 10 1/2 base pairs for a full twist in DNA How does the nucleotide sequence in one chain of DNA compare with the ...
January 9, 2007 by Becky

science
There are about 300,000,000 US citizens. If we wanted to assign each person a unique identifier, using DNA sequences, how long a DNA sequence would we need? (Here’s another way of phrasing the question: How many bases of DNA are required for there to be at least 300 million ...
September 28, 2011 by Ellen

Biology
For the DNA sequence given below, write the complementary DNA sequence that would compliment the double-strand DNA 3'--ATTGCTTACTTGCATGGTACCTCTAGCGTTTAGGC--5'
March 22, 2014 by Danielle

psychology
Which one of the following statements describe the relationship between genes,chormosomes and DNA? A genes,the basic unit of heredity,are located on chromosomes,which consist of strands of DNA B genes are composed of chromosomes and Dna C chromosomes,tha basic unit of heredity...
September 16, 2009 by 888

psychology
Which one of the following statements describe the relationship between genes,chormosomes and DNA? A genes,the basic unit of heredity,are located on chromosomes,which consist of strands of DNA B genes are composed of chromosomes and Dna C chromosomes,tha basic unit of heredity...
September 16, 2009 by VEDRANA

Psychology
Which of the following statements describes the relationship between genes, chromosomes, and DNA? a. Genes, the basic unit of heredity, are located on chromosomes, which consist of strands of DNA b. Genes are composed of and DNA c. Chromosomes, the basic unit of heredity, ...
October 3, 2011 by bj

science-important!
I really need to make sure this is correct for tommorow please help! The significance of specific base pairing in DNA is that A) it stabilizes the sugar molecule B) it provides a method for making exact copies of DNA C) it prevents errors in DNA replication D)protein copies ...
November 19, 2011 by jake

science-important!
I really need to make sure this is correct for tommorow please help! The significance of specific base pairing in DNA is that A) it stabilizes the sugar molecule B) it provides a method for making exact copies of DNA C) it prevents errors in DNA replication D)protein copies ...
November 19, 2011 by jake

Genes
Which one of the following statements describes the relationship between genes, chromosomes and DNA a) genes, the basic unit of heredity, are located on chromosomes, which consist of strands of DNA b) genes are composed of chromosome and DNA C) chromosomes the basic unit if ...
August 22, 2010 by Rena

Biology DNA
What are the components of DNA and how is the backbone of a single strand of DNA constructed? I put the components as nitrogenous base, deoxyribose molecule, and a phosphate group...I don't know the second part of the question :/
March 20, 2013 by Anonymous

psychology
Which one of the following statements describes the relationship between genes, chromosomes, and DNA? a. Genes, the basic unit of heredity, are located on chromosomes, which consist of strands of DNA.b. Genes are composed of chromosomes and DNA. c. Chromosomes, the basic unit ...
September 30, 2011 by bj

BIOLOGY
1.What is the function of DNA? 2.Name 3 parts of DNA molecule 3.Describe the shape of DNA molecule
October 7, 2009 by racheal

BIOLOGY-DNA FINGERPRINTING
Okay soo i'm confused on DNA fingerprinting, i know what it is and everything but why do they call it DNA fingerprinting when a fingerprint is only a mark left by the person?
February 24, 2010 by SAMMEHH

Chem/DNA
Convert 10mg/mL into micrograms/microliters
October 5, 2010 by Natalie

Biology
If bird DNA is more similar to crocodile DNA than turtle DNA is to crocodile DNA, then... A)birds should be included amoung reptiles B)turtles and birds should be excluded from the reptiles C)the reptiles should be replaced by several new classes D)each of the above represents...
February 8, 2011 by Carly

Bio...DNA
Can anyone explain the relationship between the structure of DNA , protein structure and phenotype of an organism? Also, what is the role of DNA in protein synthesis? I will give you a little hint. The DNA makes the RNA. The RNA makes the proteins by amino acid building blocks...
May 20, 2007 by Pet

Biology
1. Why must DNA be able to make copies of itself? 2. Define DNA replication? 3. What is the first step that must occur in DNA replication?
November 8, 2007 by Dannie

biology
i have some notes but before christmas break was here i had surgery so i didn't get to finish my notes in class and i don't understand much of my work so heres part of my notes: DNA and RNA Differences: #of strands for DNA? RNA? sugar DNA? RNA? Base that binds with Adenine DNA...
December 31, 2007 by alex

BIOLOGY
As cells get older, DNA gets damaged and lowers in DNA repair process what is the initial effect? Since this is not my area of expertise, I searched Google under the key words "DNA aging" to get these possible sources: http://www.chem-tox.com/DNA/aging.htm http://www.benbest....
March 26, 2007 by Casio

biology
How is recombinant DNA technology used today? I have to use bacterial chromosomal or genomic DNA,plasmid,restriction enzyme, vector, sticky end, transformation, DNA ligase, gene cloning,restriction fragment, and restriction site in the answer.
June 30, 2008 by H

Biology
The polymerase chain reaction (PCR) is useful for: A) making many copies of a small amount of DNA B) creating recombinant plasmids C) analyzing a person’s fingerprints D) cutting DNA into many small pieces E) allowing restriction enzymes to cut DNA at palindromes I can't ...
November 12, 2010 by stelle

Chemistry-Just checking my answer
For each template DNA, I prepared a second PCR reaction that includes "GMO" primers. Assume that all three foods had usable plant DNA. Which template DNA (non-GMO,GMO,test food) would you expect to show successful amplification of the "GMO" target sequence? I said all three ...
December 2, 2012 by Deb

Science
Can someone tell me if I answered my question correctly? During the cell cycle when does DNA replication take place? During interphase and the DNA synthesis separates the eukaryotic cells into four phases. Gap 1 phase is the intervals between mitosis and initiation of DNA ...
April 10, 2008 by Kally

Biology
17. When errors in nucleotide sequencing occur, a. DNA polymerase replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the DNA molecule d. DNA ...
February 4, 2010 by mysterychicken

Biology
17. When errors in nucleotide sequencing occur, a. DNA polymerase replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the DNA molecule d. DNA ...
February 4, 2010 by mysterychicken

Genetics
A viral DNA is analyzed and found to have the following base composition, in mole percent: A = 32, G = 16, T = 40, C = 12. What can you immediately conclude about this DNA? a stretch of double stranded DNA contains 1000 base pairs and its base composition is 58 % (G + C). How ...
September 17, 2009 by Anonymous

how do protons move during electrophoresis
During electrophoresis, protons move in the same direction as DNA. do not move at all. move in the opposite direction as DNA. move randomly. I am thinking they move in the same direction as DNA or am I wrong? DNA travels in accordance with its principal charge, negative, the ...
October 22, 2006 by Kellie Jo

dna strands/sequences
The restriction enzyme EcoR1 recognizes the DNA sequence GAATTC. Which DNA strands will be cut by EcoR1? I. TTCAGGAATTCGGAAACC AAGTCCTTAAGCCTTTGG II. TGAATCGAACCTG ACTTAGCTTGGAC III. TTAAGCGGCCGAATTCAGTCCA AATTCGCCCGCTTAAGTCAGGT IV. CAGTAGGATTTCTGTGTC GTCATCCTAAAGACACAG I and ...
October 22, 2006 by notasciencegal

Biology DNA
can somebody please explain the relationship between the structure of DNA, protein structure and the phenotype of an organism and the relationship between DNA chromatin and chromosome
May 17, 2008 by Marva

biology
A common first step in the making of a DNA library is to obtain DNA from many of your chosen organisms and cut this source DNA with a restriction enzyme. It is likely that some genes will contain sites for the chosen restriction enzyme, and in this case, your DNA library will ...
May 2, 2013 by Anonymous

Biology
14. The major components of a DNA molecular subunit are a. a chromosome, deoxyribose, and double helix b. a five-carbon sugar, phosphate group, and a nitrogen-containing base c. adenine, guanine, cytosine, and thymine d. all of the above D? 16. During DNA replication, all of ...
February 3, 2010 by mysterychicken

Biochemisty
The DNA alpha-helix structure has 566900 complete turns. The average molar mass of one base pair of nucleotides in DNA is approximately 469 g/mol. If the spacing between successive base pairs is about 0.69 nm, and a complete turn in the helical structure of DNA occurs every 6....
March 20, 2014 by Rin

Biology
Kay so these are the strands of DNA 5' C C A G T A G T T 3' 3' G G T C A T C A A 5' Let's say the DNA molecule above were the parent strand of DNA. when the strands are split for replication, which strand would be the template for the leading strand? And can you also please ...
February 20, 2011 by Melanie

science
How often would a restriction enzyme such as Not I, which has 8 nucleotides in its recognition sites 5’-GCGGCCGC-3’, cleave DNA on average? Would it cleave a species DNA more or less often if the DNA from that species were 70% A-T rich?
February 2, 2014 by Lindsey

science
how does the structure of DNA help account for the way in wich DNA copies itself
January 4, 2009 by tommy

another bio ?
what direction along a DNA strand does DNA polymerase add base pairs
November 1, 2007 by kelly

Biology
what properties/features of DNA allow DNA to have uniformity and be a universal molecule?
March 18, 2009 by Aqsa

sci 230
Missing DNA? Do we have any cells with no DNA? What would they be like? What could they be used for?
April 16, 2009 by meshelle

Biology- DNA
why dna replication necessary to life? i think it because it carry genetic information?
February 20, 2012 by Shreya

science
(a) Investigators often remove blood from a crime scene in order to extract DNA for forensics. Although blood cells do contain nucleic acids, why would blood yield relatively less DNA than semen containing sperm cells? (b)What are some other uses for DNA extracted from a human...
September 8, 2012 by peanut

DNA &RNA
State two differences between DNA and RNA. we did not study this at all, so far I see that DNA has several million nucleotides, the smaller RNA only has several thousand of them. the second thing I noticed is that they both have a base,a five carbon sugar and a phosphate group...
February 26, 2009 by sport

BIOLOGY (DNA)
Why does DNA have the consistancy of thick syrup or mucus? because of all of the different substances
August 21, 2006 by Patrick

Science
What is the purpose on DNA This is a very interesting article on the purposes of DNA. (Broken Link Removed)
July 27, 2007 by Jason

science-biology
name two processes for which DNA is responsible for what are the three components to a DNA nucleotide
March 19, 2009 by jojo

science (Genetics and Evolution)
What contains DNA? Where is DNA found? What is the difference between phenotype and genotype?
May 3, 2011 by jason

10th Grade Science
-What contains DNA? -Where is DNA found?
May 5, 2011 by Crissy XD

Chemistry-Just checking my answer
for template DNA (non-GMO,GMO,and test food) we set up a PCR reaction that included "plant' primers. Assume that all three foods had usable plant DNA. Which template DNA (non-GMO,GMO, test food) would you expect to show successful amplification of the "plant" target sequence? ...
December 2, 2012 by Deb

living environment
What is the name for the DNA molecule that would result if the two pieces of DNA were joined together?
May 7, 2009 by Anonymous

AP BIO
2. Suppose the DNA molecule were composed of six monomers. In addition to the monomers A, T, C and G, two other monomers, O and P, were present. Furthermore, O and P were known to pair only with each other. Which of following statements regarding this kind of DNA molecule ...
March 14, 2010 by Tom

biology- DNA
Explain the function and structure of DNA.
December 13, 2009 by christina

biology what is DNA
why is DNA replication necessary to life?
February 22, 2012 by Shreya

BIOLOGY
WHEN A DNA MOLECULE IS COPIED TO MAKE ANOTHER DNA MOLECULE, WHICH STATEMENT BEST DESCRIBES THE RESULTING STRANDS? A. ONE DOUBLE STRANDED DNA MOLECULE IS THE ORIGINAL AND THE OTHER A NEW COPY B. BOTH RESULTING STRANDS ARE ENTIRELY MADE OF NEW DNA BASED ON THE INFORMATION IN AN ...
October 20, 2008 by JACK

AP Biology- Molecular Genetics
The correct sequence between genes and their phenotypic expression is a) RNA-DNA-protein-trait b) DNA-RNA-protein-trait c) Protein-DNA-RNA-trait d) trait-DNA-RNA-protein I think it is either b or d but do not know if the trait is at the beginnig or end... Once translated, the ...
March 14, 2011 by Jill

Science
After replicated a DNA molecule with two strands three times, how many molecules of DNA are formed? Is eight the correct answer?
April 14, 2008 by Kally

Biology 12-DNA
suppose you knew the makeup of specific proteind in a cell. how would you determine the particular DNA code that coded for them?
January 16, 2011 by Anonymous

biology
A viral DNA is analyzed and found to have the following base composition, in mole percent: A= 32, G = 16, T = 40, C = 12. What can you immediately conclude about this DNA?
September 18, 2009 by Jessie

biology
A viral DNA is analyzed and found to have the following base composition, in mole percent: A= 32, G = 16, T = 40, C = 12. What can you immediately conclude about this DNA?
September 18, 2009 by Jessie

biology
do you have basic cell structure typical plant vs animal cells organelles- stucture and function DNA DNA replication
November 23, 2009 by kate

science
what contains DNA? where is DNA found?
May 6, 2011 by sarah

Biology
14. The major components of a DNA molecular subunit are a. a chromosome, deoxyribose, and double helix b. a five-carbon sugar, phosphate group, and a nitrogen-containing base c. adenine, guanine, cytosine, and thymine d. all of the above D 16. During DNA replication, all of ...
February 3, 2010 by mysterychicken

bio
I did a DNA fingerprinting lab and I can't understand some of the questions. 1) Different restriction enzymes are isolated from different types of bacteria. What advantage do you think bacteria gain by having restriction enzymes? 2)In your lab, you ran your DNA samples on a 0....
December 21, 2008 by bill

biology
yesterday i posted a question about who discovered DNA and Ms Sue kindly helped me but im confused about who actually discovered DNA because there are four different names Friedrich Miescher,Rosalind Franklin,james D Watson and Francis Crick. my homework question is who ...
January 18, 2011 by ANNIE

Scientists PCR
Scientists use polymerase chain reaction (PCR) to amplify a segment of DNA into many copies. to insert new nucleotide segments into a plasmid. to make a complementary strand of DNA. to link together multiple fragments of DNA WHICH ONE WOULD YOU PICK AND MOST IMPORTANTLY, WHY? ...
October 23, 2006 by Tori Renee

Experiment+ bio
In the 1950s the heavy isotope of nitrogen (15N) and an ultracentrifuge were used in an experiment to investigate the manner in which DNA replicates. Bacteria were grown in a culture containing 15N nucleotides for several generations to ensure that only heavy 15N would be ...
December 12, 2006 by Chalrey

Biology
Does it matter which strand is the 'code strand'? The following two sequences look identical, except one runs 3'-5' and the other 5'-3'. For each DNA sequence given below, write the mRNA sequence that would be coded from it. Make sure you indicate the direction of each mRNA ...
March 22, 2014 by Danielle

Probability
Automated chemical synthesis of DNA has made it possible to custom-order moderate length DNA sequences from commercial suppliers. Assume that a single nucleotide weighs about 5.6 X 10^-22 grams and that there are four kinds of nucleotides. If you wish to order all possible DNA...
January 16, 2012 by Erica

Science
Working on the Amazon River, a biologist isolated DNA from two unknown organisms, P and Q. He discovered that the adenine content of P was 15% and the cytosine content of Q was 42%. This means that: a) the amount of guanine in P is 15% b) the amount of guanine and cytosine ...
October 26, 2010 by May

science
Of all possible DNA nucleotide sequences, what sequence of base pairs would dissociate most easily into single strands if the DNA duplex were heated gently?
August 5, 2007 by H.P.

Biology
5. Dideoxynucleosides are employed in the course of the Sanger process of DNA sequencing. Dideocynucleosides are used because a) They stop the synthesis of DNA strands b) They are fluoresce c) They are radioactive d) They move quicly during gel electrophoresis e) They ...
May 8, 2014 by Deepa

Biology
Do you know, by chance, how scientists discovered the make-up of DNA? Was it via a microscope and if so, what type of microscope allows you to view the structure of DNA?
April 10, 2008 by will

chemistry
What types of linkage joins the nucleotides a) within a single DNA strand and b) between two single DNA strands?
May 7, 2008 by Mable

bio
o What are some of the benefits of squeezing so much data into virtually every cell in the body? o Why did humans not evolve with one central repository of DNA rather than having it replicated throughout the body? o Assume that the hereditary information carried in genes and ...
June 22, 2010 by Anonymous

biology
why is DNA semi-conservative? does it have something to do with two new strands are formed using the two molecules from the original DNA
January 28, 2008 by sam

biology
a DNA chip contain set of random hexanucleotide probes.out of 4096 probe how many will form perfect complementary duplexes with sequestionwithin the 14 nucleotide single target DNA 5'GAACTGCATTGATA3'
April 14, 2009 by papri

biology
a DNA chip contain set of random hexanucleotide probes.out of 4096 probe how many will form perfect complementary duplexes with sequestionwithin the 14 nucleotide single target DNA 5'GAACTGCATTGATA3'
April 14, 2009 by papri

Amber, Biology, DNA
Amber, Biology First of all, as Christina said, "Post a New Question" because when you post under someone else's post we assume it's an answer to that first question! Here are some sites for you on DNA: 1. (definition): http://en.wikipedia.org/wiki/DNA 2. (DNS from the ...
March 30, 2008 by SraJMcGin

Science
Why must chromosomes be duplicated before mitosis? DNA is the instruction of making proteins.To have a new cell that can work, it must has a replication of DNA.
September 13, 2006 by Shay

chem
Discuss, in detail, the role played by DNA and RNA in genetic diseases. What are the breakthroughs, if any, in the treatment/management of genetic diseases?
April 7, 2010 by Anonymous

Pages: 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | Next>>

Search
Members