Recent Homework Questions About Outer Space
Post a New Question | Current Questions
Math Algebra 1
For most people, buying a house is a great investment that can offer security in an uncertain world, but buying a house is also a commitment. Application Practice Answer the following questions. Use Equation Editor to write mathematical expressions and equations. First, save ...
Friday, August 15, 2008 at 8:17am
geometetry
A cow is tied to the long side of a barn 10 feet from the corner.The rope being used to tie the cow to the barn is 21 feet long .The barn measures 11 feet wide and 28 feet long, what is the total area of the space in which the cow can graze
Thursday, August 7, 2008 at 8:17pm
Chemistry
Lithium hydroxide is used in the space program to remove carbon dioxide (from respiration) in spacecraft. Specifically, lithium hydroxide, LiOH, reacts with carbon dioxide, CO2, to form lithium carbonate, Li2CO3, and water. 2 LiOH + CO2 ® Li2CO3 + H2O What mass of CO2 can...
Thursday, July 24, 2008 at 6:32pm
math
Hi there, my question has to do with areas. a tennis court is 23.8 m by 11 m. A tennis club has 3 courts side by side in a fenced area. The courts have 3 m between them and 3 m around the outside. What are the dimensions of the fenced space? please. ..
Wednesday, July 23, 2008 at 12:33am
Math
A tennis court is 23.8 m by 11 m. A tennis club has 3 courts side by side in a fenced area. The courts have 3 m between them and 3 m around the outside. What are the dimensions of the fenced space? Please and thank you!
Tuesday, July 22, 2008 at 11:54pm
science
If you were an astronaut making a space walk outside your space station when your jet pack runs out of fuel. How can you use your empty jet pack to get back to the station?
Tuesday, July 22, 2008 at 3:19am
space
can any1 answer these 2 fill in the blank questions plzzzz: 1. at the beginning the earth was __________ molten whereas the moon was ________ molten. This was because the earth is ________ than the moon. 2. Thanks to measurements on __________ rocks we have been able to find ...
Friday, July 18, 2008 at 8:17pm
Reseach paper for Sra McGin
This is what I am unsure Thanks abbreviations/ acronyms = dlete the space after / Don't forget to cover everything in the prompt = quotations, etc.
Friday, July 18, 2008 at 7:25am
physics
1. It has been suggested that rotating cylinders about 11 mi long and 5.2 mi in diameter be placed in space and used as colonies. What angular speed must such a cylinder have so that the centripetal acceleration at its surface equals the free-fall acceleration on Earth? 2. If ...
Monday, July 14, 2008 at 8:56pm
keybording and word processing
1. When keying, it's important that you keep your eyes on the A. computer monitor. B. source copy. C. keyboard. D. home row keys. 2. In the inside address of a letter, how many times do you space after a period following the abbreviation Ms.? A. None B. One time C. Two ...
Sunday, July 13, 2008 at 6:51pm
MLA Help
Can someone (preferably an english teacher) check my margins? This is the first time I've had to put an essay in true MLA format. He said that he wants the lines double spaced and a margin of 1 inch. However, I don't know whether I'm supposed to put a space between...
Sunday, July 13, 2008 at 4:09pm
History
Presidents John F. Kennedy and Lyndon B. Johnson both sought to fight poverty and racial inequality. The legislation that Kennedy proposed was called the New Frontier and that which Johnson proposed was called the Great Society. Even though some of Kennedys ideas didn...
Friday, July 11, 2008 at 8:52pm
physics
1. It has been suggested that rotating cylinders about 11 mi long and 5.2 mi in diameter be placed in space and used as colonies. What angular speed must such a cylinder have so that the centripetal acceleration at its surface equals the free-fall acceleration on Earth? 2. If ...
Friday, July 11, 2008 at 8:08am
physics
A space vehicle is traveling at 4100 km/h relative to Earth when the exhausted rocket motor is disengaged and sent backward with a speed of 76 km/h relative to the command module. The mass of the motor is four times the mass of the module. What is the speed (in km/h) of the ...
Monday, July 7, 2008 at 7:46pm
science
If you were to take off in a space ship going at the speed of light. If you didn't grow old and die would you eventually wind up where you started?
Sunday, July 6, 2008 at 1:41pm
History
Could someone review and correct my answers please. I need to decide if each item was an initiative only within Kennedys New Frontier, if it was proposed by both presidents, or if it was an initiative only within Johnsons Great Society. 1. Head Start Johnson...
Friday, July 4, 2008 at 1:45pm
Math
Can someone help me with this You have recently found a location for your bakery and have begun implementing the first phases of your business plan. Your budget consists of an $80,000 loan from your family and a $38,250 small business loan. These loans must be repaid in full ...
Sunday, June 29, 2008 at 1:02am
Algebra
An office building containing 96,000 square feet of space is to be made into apartments. There will be at most 15 one-bedroom units, each with 800 square feet of space. The remaining units, each with 1200 square feet of space, will have two bedrooms. Rent for each one-bedroom ...
Friday, June 27, 2008 at 12:43pm
English Improving writing
please check this for me a have a bit of a delema thanks again for all of you help There are on- going problems that need to be addressed at the DMD company. First there is uneven allocation of tasks. While Bonnie and Molly are working overtime at least twice a month, Jack and...
Friday, June 20, 2008 at 6:12pm
physics
If an electron is localized in space ,its momentum becoms uncertain.If it is localized in time ,its energy becomes uncertain.explain this statement.
Wednesday, June 18, 2008 at 3:08pm
French
Good evening, could you check over these sentences to see it i have translated the english correctly INTO FRENCH. Merci!! Today, we study and research space, for things like our atmosphere, the sun, asteroids and comets, moons and everything that make up our solar system. - ...
Tuesday, June 10, 2008 at 9:49pm
space
what causes a day, month and a year
Tuesday, June 10, 2008 at 12:45pm
keybording and word processing
5. Ned inserts a space after a period within an abberiviation. Ted says no space is necessary after a period within an abberivation. who is correct? a. Only Ned is correct, b. only Ted is correct, c. both are correct, d. neither is correct
Monday, June 9, 2008 at 1:30am
keybording and word processing
Ned inserts a space after a period within an abberiviation. Ted says no space is necessary after a period within an abberivation. who is correct? a. Only Ned is correct, b. only Ted is correct, c. both are correct, d. neither is correct
Monday, June 9, 2008 at 1:22am
keybording and word processing
which of the following proofreader's marks is incorrect? a. insert ^ b. stet delete c. #add horizontal space d. ¶ paragraph
Monday, June 9, 2008 at 1:21am
English Improving writing
Below is what I have to do for English It is very confusing to me General Instructions Single space your prewriting, but double space your drafts. After preparing a rough draft read the evaluation criteria and revise your work carefully, correcting any errors you find ...
Sunday, June 8, 2008 at 9:37pm
space
Suppose that the moon rises tonight at 6:00pm. Tomorrow, will it rise earlier or later?
Sunday, June 8, 2008 at 8:03pm
early childhood education
Which one of the following is probably not one of the reasons that circle times fail? a. The space was large and open b. The songs were repeated daily. c. The time period lasted too long. d. The teacher read a chapter book, hoping to encourage the children to excel.
Sunday, June 8, 2008 at 1:00am
Science
What was the size of the space station Mir? When and what did it explore? What did it find?? THANKS!!
Sunday, June 1, 2008 at 8:17pm
Biology 10
Having studied biology, and listened to instructions, you recognize there is a method that could be used to decode and solve these cryptic messages. 1) TTACTCTCAAACGCCTTATGATCAAAC 2) ATAGTTGGATTTGTTAACGGACCAAAC THE CODE TABLE --------------- AAT = A ATT = F CCC = K CTT = O AAA...
Saturday, May 31, 2008 at 1:47pm
Space
Ugh...I put red giant on my final but everyone else put white dwarf. Can you tell me which is correct. Please and thanks. :) What is brighter a red giant or a white dwarf and why? Thanks <3
Friday, May 30, 2008 at 7:32pm
English - last part
Directions: In each of the sentences below, three portions are underlined and lettered. Read each sentence and decide whether any of the underlined parts contains a grammatical construction, a word use, or an instance of incorrect or omitted punctuation that would be ...
Tuesday, May 27, 2008 at 9:59pm
English- 5
Directions: In each of the following sentences some part of the sentence or the entire sentence is underlined. Beneath each sentence you will find four ways of writing the underlined part. The first of these repeats the original, but the other three are all different. If you ...
Tuesday, May 27, 2008 at 9:27pm
Science and acrostic poems
HI! I'm making an acrostic poem about Apollo Eleven for my science class. I need help making one, so can someone give me a word for some of the letters?....(mostly the E's) A (astronauts) P O (outer space) L L (landing) O E L E V E N
Tuesday, May 27, 2008 at 5:57pm
math
here is my problems url its typed with spaces please rewrite it with out space to see the image. and it wont need password or anything go to (zshare . net )/image/126113093ead8f03 the question is to: *find the area of the shaded region. the side that i marked 19 in is actuly 9...
Monday, May 26, 2008 at 8:24pm
History
Could someone check my answers. I have to decide if each item was an initiative only within Kennedys New Frontier (K), if it was proposed by both presidents (B), or if it was an initiative only within Johnsons Great Society (J). 1.Head Start - J 2. Peace Corps - K ...
Monday, May 26, 2008 at 4:04pm
History
Could someone check my answers. I have to decide if each item was an initiative only within Kennedys New Frontier (K), if it was proposed by both presidents (B), or if it was an initiative only within Johnsons Great Society (J). 1. Head Start - J 2. Peace Corps - K...
Monday, May 26, 2008 at 4:01pm
MAT 116 Algebra 1A
Appendix D Landscape Design Landscape designers often use coordinate geometry and algebra as they help their clients. In many regions, landscape design is a growing field. With the increasing popularity of do-it-yourself television shows, however, many homeowners are becoming ...
Monday, May 26, 2008 at 2:36pm
math
here is my problems url its typed with spaces please rewrite it with out space to see the image. and it wont need password or anything go to (zshare . net )/image/126113093ead8f03 the question is to: *find the area of the shaded region.
Monday, May 26, 2008 at 12:37pm
chemistry
which quantum number, or quantum numbers, can be connected with the direction a particular orbital position points in space, regarding wave mechanics?
Monday, May 26, 2008 at 12:11am
Algebra HELP
1.You have recently found a location for your bakery and have begun implementing the first phases of your business plan. Your budget consists of an $80,000 loan from your family and a $38,250 small business loan. These loans must be repaid in full within 10 years. a)What ...
Thursday, May 22, 2008 at 8:21am
space
what kind of galaxy is the milky way?
Tuesday, May 20, 2008 at 12:17am
space
what did edwin hubble knowtice about the direction of travelof distant galaxies that led him to preopose that the universe is expanding?
Monday, May 19, 2008 at 9:00pm
space
what force holds the billions of stars in a galaxt together?
Monday, May 19, 2008 at 8:52pm
space
how long do scientists believe the universe has been expanding?
Monday, May 19, 2008 at 8:44pm
about microsoft office word
I'm typing my research paper and I'm going to indent the left,right, top, and bottom by 1 inches. what am i going to do? i have another question, how will I double space it?
Thursday, May 15, 2008 at 10:16am
Marketing
In what way is each of the following a marketing activity? a. The provision of sufficient parking space for customers at a suburban shopping mall b. The purchase by clothing store of seven dozen sweaters in assorted sizes and colors c. The inclusion of a longer and more ...
Thursday, May 15, 2008 at 3:29am
Bussiness
In what way is each of the following a marketing activity? a. The provision of sufficient parking space for customers at a suburban shopping mall b. The purchase by clothing store of seven dozen sweaters in assorted sizes and colors c. The inclusion of a longer and more ...
Wednesday, May 14, 2008 at 11:18pm
space
why we don't see comets until they are mear the sun?
Wednesday, May 14, 2008 at 8:15pm
space
why is looking through a powerful telescope like looking back through time?
Wednesday, May 14, 2008 at 7:43pm
physics
how do you compare mass and weight on the earth, moon, and outer space?
Wednesday, May 14, 2008 at 9:49am
a&p
If an astronaut returned to earth after a 180 day stay in a weightless space station he would have a decrease in bone mass? true or false?
Sunday, May 4, 2008 at 11:00am
American History
John Kennedy was fortunate to inherit a vibrant economy when he took office in 1960. -----------------------my answer False? the economy wasnt good before he stepped in the for presidency. During his presidency, he boosted the economy mostly by increasing spending on defense ...
Wednesday, April 30, 2008 at 10:55pm
Physics
When you drive down the highway, you are moving through space. What else are you moving through?
Wednesday, April 30, 2008 at 12:57am
medical office
please check my answer thanks Harper Clinic's filing system generates a gap in the filing space when the medical records are moved forward to the most recent assigned medical record number What type of numbering filing system does this clinic use? I think it is unit number
Tuesday, April 29, 2008 at 7:30pm
French
Please look over my granddaughter's application letter to Paris Disney. Thank you! Bonjour Mesdames et Messieurs, Je mappelle Kathryn ___ et je travaille au Walt Disney World Resort en Floride aux Etats-Unis. En ce moment là, je travaille avec le Disney ...
Monday, April 28, 2008 at 4:41pm
effective essay writing
to develope an essay what is time order, time space and informative process?
Thursday, April 24, 2008 at 2:23pm
sience C++ programing
could you please help me with this program even with one part please: Adding two strings (Actually, the correct term is concatenate because unlike adding two number and getting a new result, we add a second string to the end of the first one and getting a string which is ...
Friday, April 18, 2008 at 10:24am
Physics "Space Travel"
Suppose you want to go to the immense red giant Betelgeuse, which is about 500 light years away. (A light year is the distance that light travels in one year.) You plan to travel at constant speed in a 1000 ig rocket ship. A: If the rocket ship's speed is 0.500 c, ...
Thursday, April 17, 2008 at 8:07pm
Adv. Math
I don't understand these questions. I got them wrong on a test so I jus want to know what is the answer and how to do it: Which estimate is the best for 1/2 of 385? A)2 B)20 C)19 D)39 ____________________________________ The International Space Station is about 30 ft. from...
Tuesday, April 15, 2008 at 9:40pm
Physics
You need to make a 100 microH inductor on a cylinder that is 5.0 cm long and 1.0 cm in diameter. You plan to wrap four layers of wire around the cylinder. What diameter wire should you use if the coils are tightly wound with no space between them? The wire diameter will be ...
Sunday, April 13, 2008 at 2:31pm
Grammar/English
May I have someone proofread this? It is for a business presentation I have for a class scheduled today at noon. Mohegan Sun may have entered a maturity stage given that there are strong challenges to marketing management. However, Mohegan Sun cycles back into the growth stage...
Wednesday, April 9, 2008 at 10:01am
Geometry
I don't know if this is the place to put it but anyways Complete each of the following problems in the space provided if you need more space attach additional sheets. You must show all work and/or an explanation in order to receive credit. 1. Older television screens have ...
Sunday, April 6, 2008 at 6:26pm
Algebra II
The problem is:Prove that the statement 1/5+1/5^2+1/5^3+...1/5^n=1/4(1-1/5^n) is true for all positive integers n. Write your proof in the space below. How do I start this? I have looked at the only example in the book but it did not help me. Any help in this would be great!!
Saturday, April 5, 2008 at 12:56pm
medical info mangement
please help me is a web-site that may help thanks Harper Clinic's filling system generates a gap in the filing space when medical records are moved forward to the most recent assiged medical record number. Which type of the numbering filing system does this clinc use ?
Friday, April 4, 2008 at 9:14pm
Question on budget
How can I turn this into a line-item budget for personnel cost, a functional budget to calculate personnel costs per MRI procedures, and also a program (clinic) budget for providing health care services for 3000 patient visits? Someone please help I'm confused. o Cost of ...
Thursday, April 3, 2008 at 9:02pm
Algebra II
The problem is:Prove that the statement 1/5+1/5^2+1/5^3+...1/5^n=1/4(1-1/5^n) is true for all positive integers n. Write your proof in the space below. How do I start this? I have looked at the only example in the book but it did not help me. Any help in this would be great!!
Wednesday, April 2, 2008 at 6:42pm
physics
True/False (#1 only) 1)The horizontal motion of a horizontally launched projectile affects its vertical motion. False 2)The path of a projectile through space is called its. Trajectory
Tuesday, April 1, 2008 at 9:54pm
Physics
During 2004, japanese scientists successfully tested two solar sails. One had somewhat complicated shape that we shall model as a disk 9 m in diameter and 7.5 um thick. The intensity of solar energy at this location was about 1400 W/m ^2. (a) What force did the sun's light...
Monday, March 31, 2008 at 7:16pm
Algebra I
Budget is 118,250.00. Write an algebraic expression that is 25% of budget for business space and utilities.
Sunday, March 30, 2008 at 8:26pm
Math
If a = 3i + 2j - k and b = -2i + j calculate each magnitude. a) a + b I got sqrt3, but the answer at the back of the book says sqrt11. 2) If D(3,4,5) and E(-2,1,5) are points in space calculate each expression and state what it represents. |OD| can you please do those and ...
Saturday, March 29, 2008 at 4:29pm
Science-Please Help!
name two devices that we use on earth, which use the same principles as space capsules. Explain for each one.
Saturday, March 29, 2008 at 5:47am
Math
Two balls are to be selected without replacement from a bag containing one red, one blue, one green, one yellow, and one black ball. How many points are there in the sample space?
Tuesday, March 25, 2008 at 9:30pm
AP Biology
With regards to photosynthesis, if the following problems occurred, how would photosynthesis be affected? 1.) a.) NADP+ is not present in the thylakoid space b.) CO2 is not available to the plant Thanks
Sunday, March 23, 2008 at 4:40pm
Repost: Biology!
What would be the consequences of the following be on photosynthesis? These are the only ones I am stuck on! a.) Photosystem I is not functional b.) NADP+ is not present in the thylakoid space
Sunday, March 23, 2008 at 1:47pm
Biology
What would be the consequences of the following be on photosynthesis? These are the only ones I am stuck on! a.) Photosystem I is not functional b.) NADP+ is not present in the thylakoid space Thanks very much
Sunday, March 23, 2008 at 11:21am
Govt. accounting
The following information relates to Dell City, whose first fiscal year ended December 31, 2006. Assume Dell has only the long-term debt specified in the information and only the funds necessitated by the information. 1. General fund: The following selected information ...
Saturday, March 22, 2008 at 8:01pm
english
Can some read the paragraph below and check my grammars are correct. In the article Grim Climate Predictions Not Exaggerated, Analysis Says, John Roach bases on the study of The Science, John Roach reports that in the recent years the concentration of green house gas has ...
Thursday, March 20, 2008 at 1:09am
Astronomy
If a space probe were sent into orbit around the sun that brought it as close as 0.5 AU to the sun and as far away as 5.5 AU, what would its orbital period be? Can I use Kepler's 3rd law for this? I'm not sure how to take into account both AUs...
Monday, March 17, 2008 at 9:49pm
English expression
Playing the dice game, write down suitable responses and have a conversation. (They work in pairs playing the dice game. However, they use just one die.) You work in pairs. One student should throw the die. If it has one, he should move forward one step. And place the marker ...
Tuesday, March 11, 2008 at 5:13pm
Space Science
What are some possible jobs relating to the space industry?
Tuesday, March 11, 2008 at 1:57pm
Accounting
Assume that October's credit sales were $35,000. In the space below record the journal entry for the provision for uncollectible accounts under each of the following independent assumptions: a. The Allowance for Doubtful Acccounts before adjustment has a credit balance of...
Wednesday, March 5, 2008 at 9:49pm
physics
At what speed should a space probe be fired from the earth if it is required to still be traveling at a speed of 3.48 km/s, even after coasting to an exceedingly great distance from the planet (a distance that is essentially infinite)?
Tuesday, March 4, 2008 at 11:09pm
vocabulary->sentences
hi... umm i need a sentence for "confines" which means the limit of space or area,borders,boundaries
Tuesday, March 4, 2008 at 8:18pm
Math
Prove that the statement: (1/5)+(1/5^2)+(1/5^3)+...+(1/5^n)=(1/4)(1-1/5^n) is true for all positive integers n. Write your proof in the space below.
Tuesday, March 4, 2008 at 3:47pm
space
how many planets are smaller than earth
Tuesday, March 4, 2008 at 2:08am
astronomy
why is it necessary for ultrviolet telescopes to be placed on a space-based platform? thanks
Monday, March 3, 2008 at 4:13pm
physics
In a certain region of space the electric potential is V= 5x-3x^2y+2yz^2. Find the expressions for the x,y,z compenents of the electric field in this region. What is the magnitude of the field at the point P, which has coordinates 1,0,-2)m? I dont know how to start this ...
Friday, February 29, 2008 at 12:23am
workshop
Could someone help me with this. Directions Create in-text citations by following the directions for each of the following sources. Example Practice Directions: Create an in-text citation using the information from the following book. Mention the author in the text, and use a ...
Thursday, February 28, 2008 at 4:21pm
Math Linear Programming
I need to find out the constraints and the variables so that I can input and solve in excel or management scientist. I don't know how to configure this information, can someone help me? Tots Toys makes a plastic tricycle that is composed of three major components: a ...
Tuesday, February 26, 2008 at 4:23am
Algebra
(This is the info for the question NOT the actual question) A furniture company displays bedroom sets which require 21 square meters of space and living room sets which require 42 square meters of space. The company, which has 546 square meters of avalible space, wants to ...
Tuesday, February 26, 2008 at 2:25am
simplifying radicals
helo! i know how to simplify radicals but.. I dont get this one. behind of the radical (square root sign) there is a big gap before the number. Many people are saying it's a typo, but.. i dont know. there are a couple like that. example problem: square root of "space&...
Monday, February 25, 2008 at 11:39pm
Physics
With the engines off, a spaceship is coasting at a velocity of +210 m/s through outer space. It fires a rocket straight ahead at an enemy vessel. The mass of the rocket is 1350 kg, and the mass of the spaceship (not including the rocket) is 2.5 106 kg. The firing of the rocket...
Monday, February 25, 2008 at 8:32am
Math Application
A space camera circles the Earth at a height of h miles above the surface. Suppose that d distance, IN MILES, on the surface of the Earth can be seen from the camera. (a) Find an equation that relates d and h. (b) If d is to be 3500 miles, how high must the camera orbit above ...
Friday, February 22, 2008 at 6:32pm
Mathematics
A space camera circles the Earth at a height of h miles above the surface. Suppose that d distance, IN MILES, on the surface of the Earth can be seen from the camera. (a) Find an equation that relates the central angle theta to the height h. (b) Find an equation that relates ...
Friday, February 22, 2008 at 6:31pm
science
Why can't sound waves travel through empty space? I know it has something to do with vibrations.
Wednesday, February 20, 2008 at 5:44pm
Math
A dresser needs to be placed in an alcove which is 42 1/8 in high. The finished dresser is 36 1/2 inches high. What size legs should be placed on the bottom in order to leave a 1 1/2 inch space between the top of the alcove and the dresser? I got 4 1/8 inch legs and I was ...
Sunday, February 17, 2008 at 5:44pm
science
In deep space (no gravity) , the bolt (arrow) of a crossbow accelerates at 120 m/s^2 (square) and attains a speed of 124 m/s when it leaves the bow. For how long is it accelerated? Answer in units of s.
Sunday, February 17, 2008 at 4:06pm
Probability
1.) An octave contains twelve different musical notes (in Western music). How many different eight note melodies can be constructed from these twelve notes if: (a) no note can be used more than once? (b) any note can be used as often as you please...
Sunday, February 17, 2008 at 3:54pm
Intro to Probability, check some of my work please
1.) An octave contains twelve different musical notes (in Western music). How many different eight note melodies can be constructed from these twelve notes if: (a) no note can be used more than once? (b) any note can be used as often as you please...
Sunday, February 17, 2008 at 3:52pm
Intro to Probability, please check my work.
A fair coin is flipped three times. You win $5 every time the outcome is heads. Let the random variable X represent the total number of dollars you win. (a) List the sample space. (b) Determine the probability function of X. ====================== Answer: a) 2^3= 8 ...
Sunday, February 17, 2008 at 3:35pm
Computer Vision
Show that the image of an ellipse in a plane, not necessarily one parallel to the image plane, is also an ellipse. Show the the line in space is a line in the image. Assume perspective projection.
Sunday, February 17, 2008 at 11:42am
Math
The improper fraction 24/7 can be written as what mixed number? _______ (separate the whole number part from the fractional part with a space.... Write the answer like 4 5/6) is the answer 3 3/7
Friday, February 8, 2008 at 3:10pm
Graphic Design
What results from a total lack of managed white space? Under what circumstance can it be desirable?
Tuesday, February 5, 2008 at 9:14am
algebra2
Suppose it takes 3 days for a space vehicle to travel from Earth to the moon. About how long would it take for the same vehicle traveling at the same speed to Jupiter? Moon - 240,000 mi Jupiter - 391,000,000. The space vehicle would take how many days to reach Jupiter?
Saturday, February 2, 2008 at 4:15pm
alegra
IF Twenty-five percent of your budget will be used to rent business space and pay for utilities. How do you write an algebraic expression that indicates how much money will be spent on business space and utilities?
Friday, February 1, 2008 at 1:48pm
Physics
Each of the following statements has 1, 2, or 3 conceptual flaws. Explain what is wrong with each sentence (I just need help finding a website for this) 1. A rocket moves through space because the exhaust from the rocket's engine pushes against the atmosphere. 2. If an ...
Friday, February 1, 2008 at 12:04pm
algebra 1
The Question Writing Commitee consists of seven volunteers from around the country who are amazingly dedicated to the Mathcounts program. This past weekend, was the last meeting for this particular group of question writers. Before the meeting, they are put into pairs, eith ...
Thursday, January 31, 2008 at 6:16pm
Math
Eight people are put into pairs and enter a room with a large table with four pairs of chairs (2 chairs and a lot of space then 2 more chairs and a lot of space and so on) Though they could sit anywhere they had to sit with there assigned partner. In How Many ways could the ...
Thursday, January 31, 2008 at 9:19am
math
i need help in solving these 2 problems...please help..thank you... Your home is built on a square lot. To add more space to your yard, you purchase an additional 4 feet along the side of the property. The area of the lot is now 9600 square feet. What are the dimentions of the...
Tuesday, January 29, 2008 at 9:33pm
space
does our solar system move in the milky way galaxy?
Sunday, January 27, 2008 at 7:59pm
More grammar
It's me again! We're working on infinitives today, and I want to make sure I'm doing this right. Can someone check my answers for me? Thanks! "Identify the infinitive in each of the following sentences. Then identify the use of the infinitive by writing above ...
Wednesday, January 23, 2008 at 8:35pm
science- I need help!
1. How do you know when something is gas? 2. What is gas made of? [I think it's molecules and atoms?] 3. How do you know when something is matter? [I believe that when something has a mass and volume..its matter. Is that correct? 4. Is gas matter? [This question got me ...
Wednesday, January 23, 2008 at 8:03pm
science
1. How do you know when something is gas? 2. What is gas made of? [I think it's molecules and atoms?] 3. How do you know when something is matter? [I believe that when something has a mass and volume..its matter. Is that correct? 4. Is gas matter? [This question got me ...
Wednesday, January 23, 2008 at 6:06pm
Algebra
Twenty-five percent of your budget will be used to rent business space and pay for utilities. Write an algebraic expression that indicates how much money will be spent on business space and utilities. 2nd question. .25($118,250.00) correct answer? .25($118,250.00)
Tuesday, January 22, 2008 at 3:06pm
math
Find the least squares approximation of x over the interval [0,1] by a polynomial of the form a + b*e^x --------------------------------------------------------- The polynomial produces an output space with two linearly independent basis vectors: u1 = 1, u2 = e^x I ...
Friday, January 18, 2008 at 12:13am
Science - please please help
1. Explain why conduction, convection, and advection cannot occur in space. ^is it cause there is no gravity in space? 2. Does warm water rise or fall in cold water? Explain why this happens. 3. Explain why rocks and soil are poor heat sinks. Thanks in advance.
Wednesday, January 16, 2008 at 10:58pm
math
A trigonmetric polynomial of order n is t(x) = c0 + c1 * cos x + c2 * cos 2x + ... + cn * cos nx + d1 * sin x + d2 * sin 2x + ... + dn * sin nx The output vector space of such a function has the vector basis: { 1, cos x, cos 2x, ..., cos nx, sin x, sin 2x, ..., sin nx } Use ...
Wednesday, January 16, 2008 at 7:39pm
MATH HELP
14000 ACRES OF LAND 12% IS PATIO 25% LIVING SPACE AND REST IS LAWN SQUARE FOOTAGE FOR EACH PORTION OF LAND USING PERCENTAGES
Sunday, January 13, 2008 at 6:07pm
math
You are designing a web page for you school's biology club. You want to include photos of the members on the page, which has a width of 640 pixels. You've decided that the left and right magins should be 24 pixels each and the space between each picture should be 16 ...
Monday, January 7, 2008 at 7:59pm
Algebra II
A furniture company displays bedroom sets which require 21 square meters of space and living room sets which require 42 square meters of space. The company,which has 546 square meters of available space, wants to display at least 6 bedroom sets and at least 5 living room sets...
Sunday, January 6, 2008 at 3:57pm
Algebra II
A furniture company displays bedroom sets which require 21 square meters of space and living room sets which require 42 square meters of space. The company which has 546 square meters of available space,wants to display at least 6 bedroom sets and at least 5 living room sets. ...
Tuesday, December 18, 2007 at 3:04pm
Math
Statistics Help Space shuttle astronauts each consume an average of 3000 calories per day. One meal normally consists of a main dish, a vegetable dish, and two different desserts. The astronaus can choose from 10 main dishes, 8 vegetable dishes, and 13 desserts. How many ...
Sunday, December 16, 2007 at 11:58pm
physics
Three very small spheres are located along a straight line in space far away from everything else. The first one (with a mass of 2.59 kg) is at a point between the other two, 10.50 cm to the right of the second one (with a mass of 5.03 kg), and 20.40 cm to the left of the ...
Saturday, December 15, 2007 at 5:08pm
Physics
Three very small spheres are located along a straight line in space far away from everything else. The first one (with a mass of 2.43 kg) is at a point between the other two, 10.60 cm to the right of the second one (with a mass of 5.17 kg), and 20.70 cm to the left of the ...
Saturday, December 15, 2007 at 10:45am
statistics
A specific brand of bike comes in two frames, for males or females. Each frame comes in a choice of two colors, red and blue, and with a choice of three seats, soft, medium, and hard. a) Use the counting principle to determine the number of different arrangements of bicycles ...
Thursday, December 13, 2007 at 8:00pm
Algebra (word problems)
1) a small pipe can fill a tank in 16 min more time than it takes a large pipe to fill the same tank. Working together, both pipes can fill the tank in 6 min. How long would it take each pipe working alone to fill the tank? 2) a car travels 240 mi. a second car, travelling 12 ...
Wednesday, December 12, 2007 at 10:13pm
college math
A couple plan to have exactly three children. (a) Construct a tree diagram and list the sample space. (b) Find the probability that the family has at least two girls.
Tuesday, December 11, 2007 at 9:46pm
Photo Essay...
Ummmm.... Sorry, I forgot to mention that I am already about halfway through it, and I can't seem to get back into it. Being a reflection, it is fairly informal, so I simply describe the photos and then explain their meaning. I just always seem to veer away from the screen...
Sunday, December 9, 2007 at 10:38pm
area of a rectangle, i think?
Okay, so Spot the dog is on a 10 foot leash. The leash is attatched to the CENTER of a 24ft by 8ft rectangular shed. So basically, imagine a 24 by 8 rectangle, with a leash attatched to the CENTER of the 24in side. K? - I NEED TO ANSWER THESE 2 QUESTIONS by tommorrow!!! A. ...
Sunday, December 2, 2007 at 3:01pm
Economic Geography
The geography of consumption if different from geography of production. Why? What does it mean to say that our geographies of consumption are becoming increasingly disjunct from the geographies of other aspects of our everyday lives (work, school, etc)? what does this ...
Saturday, December 1, 2007 at 6:53pm
math
Consider yourself a genetic counselor. Megan and Eric come to you for your services. They are planning on having their first child. Megans father died from Huntingtons disease. Erics family has no history of Huntingtons disease. They would like to have ...
Monday, November 26, 2007 at 12:14pm
Can someone proof read please
This is the orginial assignment, and I am suppose to rewrite it. I am a new publisher with some really great books to sell. I saw your announcement in Publishers Weekly about the bookseller's show you're having this summer, and I think it's a great idea. Count me ...
Saturday, November 24, 2007 at 4:26pm
Business Communication
Will someone look over my answers and think this is okay? The assignment is and I'm suppose to find the strengths and weaknesses. I am a new publisher with some really great books to sell. I saw your announcement in Publishers Weekly about the bookseller's show you'...
Thursday, November 22, 2007 at 10:30pm
Business Communication
Will someone look over my answers and think this is okay? The assignment is and I'm suppose to find the strengths and weaknesses. I am a new publisher with some really great books to sell. I saw your announcement in Publishers Weekly about the bookseller's show you'...
Thursday, November 22, 2007 at 10:26pm
space science
how long does it take for our solar system to rotate around the Milky Way galaxy?
Monday, November 19, 2007 at 11:16pm
Physics
How much force are you exerting on the earth right now? How can a rocket operate in outer space? Describe the process of walking.
Monday, November 19, 2007 at 8:23pm
Movement
Which is the least challenging element of movement? shape,time,flow, or space? Isn't space the least challenging?
Thursday, November 15, 2007 at 7:58pm
Early Child Ed.
1. A classroom activity that requires children to find their name cards at Circle Time or on the Daily Duties chart affords an opportunity for: A) the teacher to observe the child's active participation in classroom responsibilities. B) noting the child's adjustment to...
Friday, November 9, 2007 at 7:26pm
MATH
Please help me with these problems. Work and answer is appreciated! :) thanks. 1. Find on the interval theta is greater than or equal to 0 and less than 2pi; then find the general solution: 5tantheta+1=-2.89 16cos^2theta-6=3 6sin^2theta+sintheta=2 costheta=.84 2tanx=7 2.Find ...
Wednesday, November 7, 2007 at 12:01am
Physics repost please check
Posted by Mary on Monday, November 5, 2007 at 8:19pm. A charged particle, passing through a certain region of space, has a velocity whose magnitude and direction remain constant. (a) If it is known that the external magnetic field is zero everywhere in this region, can you ...
Tuesday, November 6, 2007 at 11:48am
Physics
A charged particle, passing through a certain region of space, has a velocity whose magnitude and direction remain constant. (a) If it is known that the external magnetic field is zero everywhere in this region, can you conclude that the external electric field is also zero? ...
Monday, November 5, 2007 at 8:19pm
Chem
The space probe Pioneer 11 was launched April 5,1973, and reached Jupiter in December 1974 traveling a distance of 998 million km. How long did it take an electromagnectic signal to travel to earth from Pioneer 11 when it was near Jupiter. The speed of light is, for all ...
Saturday, November 3, 2007 at 4:42pm
science
rutherford = an atom is mostly empty space with a dense positively charged nucleus in the center do you agree
Saturday, November 3, 2007 at 12:13am
science
Are these correct for Democritius Help so confused - I read site and still trying to figure out. atoms of same element are exactly alike an atom is mostly empty space with a dense - postiveily chareged nucleus These are the choices Rutherford wave model dalton Bohr democritus
Friday, November 2, 2007 at 10:32pm
Chemistry
The space probe Pioneer 11 was launched April 5,1973, and reached Jupiter in December 1974 traveling a distance of 998 million km. How long did it take an electromagnectic signal to travel to earth from Pioneer 11 when it was near Jupiter. Where do I begin???
Thursday, November 1, 2007 at 9:32pm
Chem
The space probe Pioneer 11 was launched April 5,1973, and reached Jupiter in December 1974 traveling a distance of 998 million km. How long did it take an electromagnectic signal to travel to earth from Pioneer 11 when it was near Jupiter.
Thursday, November 1, 2007 at 6:11pm
computer forensics
1.Check the operating systems swap file. Using the WinHex to go through the swap file, have you found any interesting results? 2.Design a plan to check the ram slack and drive slack on your computer with the tool WinHex. Report your findings. 3. Use WinHex to check ...
Wednesday, October 31, 2007 at 3:13pm
English
How does this poem sound? I told my friends I was no scaredy cat, Not afraid of snakes, nor bears or bats. The said Oh, well thats sure to change, When you spend a a night in a house thats strange. They dared me to sleep in an abandoned house on Brown, ...
Sunday, October 28, 2007 at 10:31am
Science
QUESTION: "Make a hypothesis about how space craft that travel through the solar system obtain the energy they need to operate." We are studying energy forms in class (Kenetic, Potential, Nuclear, etc.)... i need help NOW!
Thursday, October 25, 2007 at 10:45pm
Pages: <<Prev | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | Next>>
Post a New Question | Current Questions
For Further Reading