Recent Homework Questions About Biology
Post a New Question | Current Questions
Biology
Hey! :) When looking at the surface area to volume ratio of a cell it's meant to be that the larger this ratio the more efficient the cell is in diffusion etc. I don't get how a ratio of 6:1 though could be the larger ratio in comparison to 54:27...Im just confused ...
Tuesday, August 23, 2011 at 6:27am
biology
The height of a man grows on cell division.During cancer there will be uncontrolled mitotic division.That is cell divides continuosly.Does the height of the person increase when he get cancer.
Monday, August 22, 2011 at 1:52pm
math
who are the fathers of following subjects a)maths b)physics c)chemistry d)biology e)social
Monday, August 22, 2011 at 9:24am
biology
what is the difference between a chemical that is an irritant compared to a chemical that is corrosive?
Sunday, August 21, 2011 at 4:59pm
biology
what is Rh factor?
Sunday, August 21, 2011 at 6:09am
biology
The effect of gravity on seed germination. why do plants grows towards light
Sunday, August 21, 2011 at 1:16am
Biology
Hypothesis on finding if the dissappearance of a particular fish species from a lake in the northwestern united states is due to acid rain resulting from industrial air pollution
Saturday, August 20, 2011 at 7:42pm
biology
Describe the concept of natural selection. Give some examples.
Thursday, August 18, 2011 at 9:24pm
biology
In reference to plant and animal adaptations, how are the principles of heredity and genetics applicable to how organisms change over time?
Friday, August 12, 2011 at 5:38pm
biology
What are two behaviors in either a plant or animal that demonstrates a circadian rhythm?
Friday, August 12, 2011 at 3:30pm
Biology
There are many differences between the two major cell types: prokaryotes and eukaryotes. However, the different structures and modes of organization perform basically the same functions. Briefly compare and contrast the different features or functions of prokaryotes and ...
Friday, August 12, 2011 at 10:09am
Biology
What is the primary focus on all biological studies?
Thursday, August 11, 2011 at 7:41pm
BIOLOGY
Please tell me if I am getting them right? PLEASE HELP In a moist area of the woods, you see a mass of small, green plants with tall, thin, non-green projections coming from their centers. These plants are probably A. seed-bearing. B. nonvascular. *** C. drought-resistant ...
Wednesday, August 10, 2011 at 9:57am
biology
Define and distinguish between self-fertilization, cross-fertilization, true-breeding organisms, hybrids, the P generation, the F1 generation, and the F2
Monday, August 8, 2011 at 2:11pm
biology
Hey, I was wondering out of alveoli and red blood cells which had the larger surface area to volume ratio, and whether the one with larger would be generally more efficient in diffusion. Any help or other info on this would be very much appreciated :) Thanks
Friday, August 5, 2011 at 8:13pm
biology
from the phenotype of the kernals on each P generation cob what would the predicted genotype of any F1 plant be?
Wednesday, August 3, 2011 at 10:02pm
biology
Based on what you know about phenotypes and figure 2 for the p generation what is the corn plant genotype on each cob containing the P corn kernals
Wednesday, August 3, 2011 at 10:00pm
biology
an investigation was done to determine the role of petals in insect pollination in apple flowers.when flowers are self pollinated,the tubes grow a little into the stigma and style and fertilization does not take place.(1)10 flowers with petals and 10 flowers without petals ...
Wednesday, August 3, 2011 at 1:29pm
biology
A scientist wishes to determine how effective a vaccine is in protecting rats against a contagious disease. What experimental procedure should the scientist use to determine the vaccine's effectiveness?
Sunday, July 31, 2011 at 5:41pm
biology lab
how to know from the experiment if the oxygen produced as a result of carbon fixation or electron transport? my experiment result show that average bubble/min for tap water is 4.7 while NaHCO3 is 1.8.
Sunday, July 31, 2011 at 4:12pm
biology lab
-rate of photosyhthesis in presence of light intensity & CO2. ~A : sodium bicarbonate in darkness pH b4 xperiment-9 " @ 20 min- 8 " 60 min- 8 ~B: sodium bicarbonate in room light pH b4 xperiment-9 " @ 20 min-9 " 60 min-8 ~C: sodium bicarbonate 20 cm from ...
Saturday, July 30, 2011 at 9:03pm
biology
what is the original color of Phenolphthalein solution? pink or colourless?
Saturday, July 30, 2011 at 2:33pm
biology
how to calculate the class average of millilitres of CO2 exhaled per minute?
Friday, July 29, 2011 at 11:25am
biology
what compound is formed when CO2 is bubbled through water?show the reaction.
Friday, July 29, 2011 at 11:24am
biology
how does concepts of chemistry affect biology?
Tuesday, July 26, 2011 at 6:20pm
biology
i need an article that can explain the scientific method to create hypothesis or designing an expermient
Tuesday, July 26, 2011 at 4:28pm
Biology
Write true or false: 1. A root hair is a small extension of an epidermal or outermost cell layer of a dicot root 2. Layers of parenchyma cells make up the cortex of a dicot root and the central pith of a monocot root. 3. Outside the endodermis is a tissue called the pericycle ...
Monday, July 25, 2011 at 7:42am
biology
how many chromosomes are present in ostrich? how many chromosomes are present in monkey? how many chromosomes are in lacto bacteria
Sunday, July 24, 2011 at 2:57am
Biology
What happened if you put the Elodea leaf cells in a solution of 0.5% NaCl,1.8% NaCl and 0.9%NaCl?
Saturday, July 23, 2011 at 1:31pm
biology
how can i identify the cell if it is plant or animal cell??
Saturday, July 23, 2011 at 3:49am
science-biology..cells
please give me those parts of animal cell and plant cell.. please seperate it..
Saturday, July 23, 2011 at 3:35am
biology
You are attempting to determine whether a plant-derived processed food sample (for example, a corn chip) contains material from a genetically-modified organism (GMO). First, you crush the sample and attempt to extract DNA from it. Next, you perform PCR using two different sets...
Friday, July 22, 2011 at 7:17pm
Biology
Briefly describe what effect you expect each of the following variables to have on enzymatic activity. 1. pH of 3.0 2. decrease in temperature 3. increase in substrate concentration 4. increase in enzyme concentration 5. addition of phenylthiourea(PTU)
Friday, July 22, 2011 at 3:45pm
biology
lipid soluble toxins must be oxidized before they are excreted from.otherwise the toxins would not be able to pass through the a)bowman capsule b)red blood cells c)cell membranes d)cytoskeleton
Friday, July 22, 2011 at 10:44am
biology
(Which of the following would least likely induce thirst) a)Dry pharynx b)Decrease blood volume c)decrease blood pressure d)decreased blood osmolarity
Friday, July 22, 2011 at 10:43am
biology
(Which of the following would least likely induce thirst) a)Dry pharynx b)Decrease blood volume c)decrease blood pressure d)decreased blood osmolarity
Friday, July 22, 2011 at 1:28am
biology
lipid soluble must be oxidized before they are excreted from.otherwise the toxins would not be able to pass through the a)bowman capsule b)red blood cells c)cell membranes d)cytoskeleton
Friday, July 22, 2011 at 1:27am
biology: genetics
You are attempting to determine whether a plant-derived processed food sample (for example, a corn chip) contains material from a genetically-modified organism (GMO). First, you crush the sample and attempt to extract DNA from it. Next, you perform PCR using two different sets...
Wednesday, July 20, 2011 at 1:02pm
biology
hemophilia is a sex linked recessive disorder. A man who has a hemophilia has a daughter who has a normal phenotype. She marries a man who also does not have hemophilia. what is the chance that they will have a daughter who has hemophilia? what chance will their son have ...
Wednesday, July 20, 2011 at 12:48pm
biology help
color blindness is a sex linked disorder caused by recessive allele on the X chromosome. XC= normal vision. Xc= color blind. if a normal vision man marries a color blind woman, what are the chances that they will have a color blind son? what a color blind daughter? show your ...
Tuesday, July 19, 2011 at 6:33pm
biology
In Drosophila melanogaster, cut wings (ct) is recessive to normal wings (ct+), sable body (s) is recessive to gray body (s+), and vermilion eyes (v) is recessive to red eyes (v+). All three recessive mutations are X- linked. A female fly with cut wings, sable body, and ...
Monday, July 18, 2011 at 10:10am
biology: genetics
In Drosophila melanogaster, cut wings (ct) is recessive to normal wings (ct+), sable body (s) is recessive to gray body (s+), and vermilion eyes (v) is recessive to red eyes (v+). All three recessive mutations are X- linked. A female fly with cut wings, sable body, and ...
Sunday, July 17, 2011 at 10:11pm
Biology
In your own words, explain the second law of thermodynamics and explain why it is not violated by living organisms?
Sunday, July 17, 2011 at 5:58pm
Biology
What is the "biological hierarchy"? Is it kingdom, phylum, class, order, family, genus, species? Or is it organelle; cell; tissue; organ; organism; species; community; population; ecosystem; biosphere? Which one is it referring to?
Sunday, July 17, 2011 at 2:00pm
biology
some people in old age complain of stiff joints. what is the possible reason for it? please help, need answer related to bones and joints, level middle school biology
Saturday, July 16, 2011 at 11:14am
biology
some people in old age complain of stiff joints. what is the possible reason for it?
Saturday, July 16, 2011 at 9:54am
biology
1 mole of an element or compound contains 6.20 times 10 to the 23rd power atoms or molecules of the element or compound. 1 mole of an element or compound has a mass equal to its mass number (or molecular weight) in grams. For example, 1 mol of hydrogen gas (H2) contain 6.02 ...
Friday, July 15, 2011 at 8:56pm
biology
a student used water as a medium in a temporary blood stick. he could observe only ruptured cell under microscope. why doese this happen ? plzzzz tell flash.
Friday, July 15, 2011 at 2:24am
biology
in what way are chloroplast and mitochondria similar ?
Friday, July 15, 2011 at 1:51am
biology
in what way are chloroplast and mitochondria similar ?
Friday, July 15, 2011 at 1:49am
biology
in what way are chloroplast and mitochondria
Friday, July 15, 2011 at 12:26am
biology
How is bacterial cell different from an onion peel cell ?
Friday, July 15, 2011 at 12:23am
biology
How is bacterial cell different from an onion peel cell ?
Thursday, July 14, 2011 at 4:33am
critique my reflection paper
i revised it and found my mistakes.. ignore my conclusion because it's not good i'm going to work on it. I have been an English 101 student for about 3 weeks now, and over the course of my stay, I have learned a lot more than I thought possible. I learned to write, to ...
Tuesday, July 12, 2011 at 9:47pm
critique my reflection paper
first of all, im an ESL English student so bear with my mistakes I have been an English 101 student for about 3 weeks now, and over the course of my stay I have learned a lot more that I thought possible. I learned to write, to express myself, how to think for myself, and how ...
Tuesday, July 12, 2011 at 8:26pm
biology
the differences between a living thing and non living thing (essay)
Tuesday, July 12, 2011 at 3:24pm
biology
assuming that there are 5 bacteria found in a glass of water. what is the population. of bacteria if it will not be controlled for 6 hours?
Monday, July 11, 2011 at 9:19am
Biology
The article is presented by HomeworkEasy experts out of five years of stead fast dedication to help students with their biology assignments, homework and projects. Origins of biology as a field are expounded and the academic possibilities are briefed. The spicy narration oh ...
Monday, July 11, 2011 at 2:35am
biology help
Is photosynthesis only occurring during the daytime? What happens when there is no light? What is the relationship between light dependent and light independent reactions in photosynthesis?
Sunday, July 10, 2011 at 11:02pm
biology help
Does photosynthesis require energy? What type of energy reaction would photosynthesis be? Is photosynthesis an example of a coupled reaction?
Sunday, July 10, 2011 at 10:32pm
biology
What are coupled reactions? Describe the interactions between enzyme, substrate, active site and the induced fit model Explain how changes in temperature, and pH affect the function of enzymes Recognize the structure of ATP, and be able to identify some key functions of ATP. ...
Sunday, July 10, 2011 at 9:47pm
SraJMcGin-biology
just wanted to say thankyou :)
Saturday, July 9, 2011 at 10:03am
biology
1.explain how the code that is found in the organism`s genes works 2.describe how the genetic code controls the production of proteins 3.find diagrams to help explain thankyou!
Saturday, July 9, 2011 at 8:52am
biology
Melanin pigment can be present in which of the following eye colors? a. hazel b. brown c. blue. d. all of these e. none of these is it d?
Tuesday, July 5, 2011 at 7:53pm
biology
Which of these statements concerning the centromere is NOT true? a. it appears to join dupicated DNAs b. It anchors proteins to DNA. c. Its position along the chromosome varies d. It is visible as a constriction on the chromosome. e. IT is where sister chromatids attach to ...
Monday, July 4, 2011 at 8:48pm
biology
Growth factors a. are adhesion substances b. inhibit the cell cycle c. can cause neoplasms d. invite transcription of growth genes e. are nucleic acids is it b?
Monday, July 4, 2011 at 8:35pm
biology
what is the scientific study of heredity
Monday, July 4, 2011 at 3:20pm
biology
In chickens, males have two Z sex chromosomes (ZZ) and females have one Z and one W sex chromosome (ZW). The mechanism for inheritance of the sex chromosomes is exactly the same as for X and Y sex chromosomes in other species. In chickens the character of barred or...
Monday, July 4, 2011 at 1:50pm
biology
A poultry farmer hopes to profit from the current craze for keeping egg laying chickens as pets and wishes to increase his stock of interesting and unusual breeds. (a) The farmer crossed a pure-breeding white chicken with a pure-breeding black chicken and found that 100% of ...
Monday, July 4, 2011 at 1:50pm
biology
compare fermentation and cellular respiration. i found the contrast of these two but couldnt find the comparisons for these.
Wednesday, June 29, 2011 at 11:56pm
biology
How do c3, c4, and CAM plants survive under dry conditions?
Tuesday, June 28, 2011 at 10:23pm
biology
Describe how the human defense line work.
Tuesday, June 28, 2011 at 1:43am
biology
what are the effects of tonicity in red blood cells?
Monday, June 27, 2011 at 1:26am
biology
Can someone please tell me if this paragraph makes any sense at all? I feel like I contradict myself, as I do not understand the subject very well. Thank you. "Since neither of the parents in the pedigree has the genetic disorder (as indicated by their non-darkened ...
Monday, June 27, 2011 at 1:09am
Biology
Good day! I actually just have one question and I have been looking at links and everything, but i still dont understand>>>>... "What abiotic factors seem to be the greatest determinants of terrestrial biome locations?"
Sunday, June 26, 2011 at 2:53pm
English
I need you to check the question and my answer to it. Shall I include more details in the question? In sentences 3 and 5 I don't know which connectors to use (to express a contrast between two different concepts). How can't find a suitable verb to finish of my ...
Sunday, June 26, 2011 at 5:38am
biology
Which has more redox energy Lysine or Tryptophan? I was thinking Lysine because it has a long chain C-H and C-C bonds but trypyophan has a cyclic structure that also have lots of C-C and C-H bonds. Please help!
Saturday, June 25, 2011 at 8:02pm
biology
1. Which statement is TRUE? a. A cell placed in an isotomic solution will swell. b. A cell placed in a hypotonic solution will swell. c. A cell placed in a hypotonic solution will shrink. d. A cell placed in a hypertonic soluction will remain the same size. e. A cell placed in...
Saturday, June 25, 2011 at 12:31am
biology
Little Mito grew up in a one-room house in the Eukaryote family. His neighborhood consisted of one- room houses just like his, and everyone got along real well. He grew up with his sister, Chlora, his older brother, Flag, and his cousins, ER and Nuc. Each of them had their own...
Friday, June 24, 2011 at 10:17pm
biology
2more questionsss ! dats it ! 1. Which statement is TRUE? a. A cell placed in an isotomic solution will swell. b. A cell placed in a hypotonic solution will swell. c. A cell placed in a hypotonic solution will shrink. d. A cell placed in a hypertonic soluction will remain the ...
Friday, June 24, 2011 at 9:35pm
biology
1. The energy used by living organisms a. is declining through time. b. is derived by breaking bonds that hold the atoms in organic molecules together. c. involves ionic bonds more often than covalent bonds. d. is available only from glucose when it undergoes respiration. e. ...
Friday, June 24, 2011 at 9:16pm
biology
what is the metric units used for 1. distance 2. length 3. volume 4. weight or mass?
Thursday, June 23, 2011 at 12:31am
Biology
why does "crossing over" involve non sister chromatids(homologues) instead of sister chromatids?
Wednesday, June 22, 2011 at 11:41pm
PSYCHOLOGY
the study of similarities and differences in the behavior of different species called (biology, comparative psychology, environmental psychology, diffential psychology)
Wednesday, June 22, 2011 at 5:43am
Biology
Human vision can distinguish objects down to about a 4th of a millimeter (~250 micrometers). Given this, which of the following are generally visible to the human eye? Proteins Bacterial cell Animal cell Poxvirus Ribosomes Plant cell None of the above I think none of the above...
Monday, June 20, 2011 at 9:59pm
BIOLOGY
How many hydrogen atoms will bond with each nitrogen atom?
Monday, June 20, 2011 at 9:58pm
Biology
You are observing a slide of green cells under the 4X objective. Each cell covers roughly 1/8th of the width of your field of view. How large of a diameter do these cells have? The equation I found is: Size of cell= field diameter/ # of cells that fit across field So the ...
Monday, June 20, 2011 at 9:58pm
Statistics Math Help
A distribution of 800 test scores in a biology course was approximately normally distributed with a mean of 35 and a standard deviation of 6. Calculate the proportion of scores falling between 20 and 40
Saturday, June 18, 2011 at 1:10am
Statistics
A distribution of 800 test scores in a biology course was approximately normally distributed with a mean of 35 and a standard deviation of 6. Calculate the proportion of scores falling between 20 and 40
Saturday, June 18, 2011 at 1:09am
biology
in a dihybrid cross, the F2 will have nine genotypes, but only four phenotypes because the _, genes cause the _, traits to mask the _, traits
Friday, June 17, 2011 at 11:48am
biology
What is a possible system that can be used to test respiration in a small animal?
Thursday, June 16, 2011 at 6:43pm
Biology
Biology question about molecules? I need to arrange the following in terms of smallest to largest representative size... triglyceride, disaccharide, carbon atom, protein, carboxylic acid please help! thank you!!
Wednesday, June 15, 2011 at 8:34pm
Biology
Carbon is a an element with an atomic number of 6. Based on this information, which of the following statements is true? A. Carbon can be broken down into simpler component substances. B. Each carbon atom will always have 6 protons. C. Each carbon atom will always have 6 ...
Wednesday, June 15, 2011 at 2:44am
Biology
You are a botanist hired in the future to make a distant planet, Xyloph, habitable for human life. Your job is to help seed the planet with plant life by working with the Terraforming Team. All four major kinds of plants will be introduced into this new world. You are to help...
Sunday, June 12, 2011 at 12:07pm
biology
flow chart for respiration and digestion
Sunday, June 12, 2011 at 2:29am
biology
name the gas transporting protein molecule present in the blood ? why this molecule is employed to transport oxygen but not carbondioxide.
Saturday, June 11, 2011 at 10:54pm
Biology
How could a farmer tell whether his tomatoes are pure red or heterozygous?
Saturday, June 11, 2011 at 4:59pm
biology
difference between gaseous exchange, respiration and breathing
Friday, June 10, 2011 at 10:55am
biology
I did a lab with catalase breaking down hydrogen peroxide. A question asks, what gas is being formed (oxygen), suggest a method I could use to determine this. I don't know any method?
Thursday, June 9, 2011 at 9:54pm
BIOLOGY
WHAT ARE THE COMPLEMENTARY BASE SEQUENCE FOR THE FOLLOWING DNA MOLECULE: GCCTACGATGCTTGTACTGAA
Tuesday, June 7, 2011 at 2:30pm
Biology
a cell is placed in distilled water and then transferred to a 5% salt solution. aw a result of this procedure, the cell would be likely yo?
Thursday, June 2, 2011 at 7:42pm
Biology
Wha advantage could the following traits be to the organism ? a) Larger leaves b)Green Leaves c) More seeds d) Brightly coloured flowers
Wednesday, June 1, 2011 at 6:56pm
biology
1. Record your observations of the roots of the bean and radish plants in the appropriate data chart. Be sure to include a sketch of each plants roots. Answer: Data Chart: Bean Plant Nodules present? Number of nodules Number of pink nodules Number of green nodules Sketch...
Wednesday, June 1, 2011 at 3:38pm
English
Could you please check these adjectives referring to personality? Thank you very much. 1) I'm outgoing, sensible, sincere, touchy and hard-working. 2) I'm quite confident about myself. I'm anxious about next week's biology test. 3) If I were you, I'd study ...
Wednesday, June 1, 2011 at 10:16am
Biology
What kind of animals have eggs that contain yolk? Do all eggs have yolk?
Sunday, May 29, 2011 at 9:13pm
Biology
What are the advantages of a Co-repressor?
Sunday, May 29, 2011 at 1:42pm
biology
What are different ways antibodies can react with antigens, that aids in preventing a host from being infected.
Wednesday, May 25, 2011 at 10:17pm
Biology
What is in urine after in has been filtered thrigh the kidneys?
Wednesday, May 25, 2011 at 12:23pm
Biology(HELP ME!!!)
An average person blinks their eyes about 20 times per minute. Estimate the number of times a person will blink in 1 year.
Monday, May 23, 2011 at 7:55pm
SCIENCE(biology)
define sustainable agriculture
Sunday, May 22, 2011 at 6:37am
I really need help with biology!!
I need help understanding my bio assignment. Can you tell me weather or not I got them right and if I didnt get them right can you correct them and tell me the right answer to give me a better understanding? I put a star (*) next to my answer. 1. Which type of muscle makes up ...
Friday, May 20, 2011 at 11:14pm
biology
true or false? a mammal that can learn to find its way through a maze more quickly than another mammal probably has a better developed cerebellum
Friday, May 20, 2011 at 5:03pm
Biology
true or false Ciliates use flagella for feeding and movement?
Friday, May 20, 2011 at 4:44pm
biology/honors
Charle Darwin made theory of natural selection but couldnt explain why there is variation within populations. Explain two reasons why there is variation within population ? PLEASE help me answer this question is for my test
Friday, May 20, 2011 at 2:39pm
biology
why is the cell membrane important to people?
Thursday, May 19, 2011 at 8:39pm
biology/honors
How does genetic variation lead to speciation ? Can you help me answer this question please for the review test ? thank you .
Thursday, May 19, 2011 at 7:36pm
biology/honors
Can someone help answer this question please is one of my study guide for the test? What are some adaptation that hominid populations developed as opposed to primates ? thank you
Thursday, May 19, 2011 at 6:29pm
biology
compare the size of a guard cell to the size of a chloroplast. does the guard cell have room for more chloroplast
Wednesday, May 18, 2011 at 9:50pm
Biology
Among protostomes, which morphological trait has shown the most variation? A. Type of symmetry (bilateral vs. radial vs. none) B. Type of body cavity (coelom vs. Pseudocoelom vs. acoelom) C. Number of embryonic tissue types (diploblastic vs. triploblastic) D. Cephalization (...
Wednesday, May 18, 2011 at 5:25pm
biology
do mutations form new or old genes????
Wednesday, May 18, 2011 at 1:34am
biology
i need a short story about a ecosystem that is disturbed and undergoes succession
Tuesday, May 17, 2011 at 7:10pm
Biology Help!
what r Unstable elements that give off radiation what r Tiny vesicles that form when short chauns of amino acids gather together
Tuesday, May 17, 2011 at 5:49pm
Biology
The half life of carbon 14 is 5700 years. If the carbon 14 level measured in a fossilized bone has only 1/4 of the original amount, how old in the bone?
Monday, May 16, 2011 at 8:07pm
Biology
Does the circulatory system transport red and white blood cells? If so, how?
Sunday, May 15, 2011 at 9:13am
Biology
Name two ways in which antibodies in the blood will prevent a pathogen from making you sick. This is all I can think of: 1. An antigen in the body will bind to an antibody that was made by...
Friday, May 13, 2011 at 1:42pm
biology pleaseehelp!
In order to produce many copies of a protein fast, the cell uses A. DNA replication. B. intron self-splicing. C. single-unit ribosomes for high speed translation. D. codon-anticodon reciprocal duplication. E. many RNA polymerase molecules to produce mRNA transcripts at the ...
Friday, May 13, 2011 at 1:49am
biology
can alcohol go through a visking tubing?
Thursday, May 12, 2011 at 9:23am
biology
Discuss possible benefits and drawbacks of a transgenic organism such as Bt corn?
Wednesday, May 11, 2011 at 2:23pm
biology
Are different species always fery different?
Tuesday, May 10, 2011 at 12:45am
Biology
The number of oyster beds in Chesapeake Bay,which is an arm of the Atlantic Ocean,is dwindling rapidly.what effect would this have on the surrounding area?On the human community?
Tuesday, May 10, 2011 at 12:27am
Biology 1
What is a Biochemical cycle and why is it important? Give at least one example.
Monday, May 9, 2011 at 8:56pm
Grade 12 Biology
If a life-form has six different bases-ABCDEFG. the percentage composition of A,B and C is same as EFG. Hypothesis the structure of the nucleic acid. I TRIED the search engine but didnt help, please help!
Monday, May 9, 2011 at 3:43pm
biology
Would you like to help me answers some of my questions in Biology? 1/ Darwin concluded that the most well adapted individuals in a population will leave the most offspring for future generations. This can be considered a measure of an individual's.. a/ phylogeny b/ family ...
Sunday, May 8, 2011 at 11:03pm
Biology
How would you perform a 5 x 10^-3 dilution of any culture or chemical reagent?
Sunday, May 8, 2011 at 8:25pm
Anthropology
How does the identification of cultural universals impact our understanding of what it means to be human. How does the search for Universals help us better understand human cultural behavior? What examples for out own culture can illustrate the ideas that our behaviors are ...
Sunday, May 8, 2011 at 11:48am
biology
14 points Save A photosynthesis experiment uses Chlorella to track the route taken by 14C in photosynthesis. The 14C is provided from CO2 and no new sources of CO2 are available. After the experiment the scientist extracts all of the starch produced and analyses the Carbon ...
Saturday, May 7, 2011 at 9:01am
science - biology
A photosynthesis experiment uses Chlorella to track the route taken by 14C in photosynthesis. The 14C is provided from CO2 and no new sources of CO2 are available. After the experiment the scientist extracts all of the starch produced and analyses the Carbon present. She ...
Saturday, May 7, 2011 at 8:57am
Biology
What are the three types of fibers which comprise the cytoskeleton?
Friday, May 6, 2011 at 2:14pm
Biology
What is combined in the chloroplast to make glucose?
Friday, May 6, 2011 at 2:13pm
biology
Sugar maple trees are tapped in the spring. how far into the tree would you haev to go to tap the syrup?
Thursday, May 5, 2011 at 7:03pm
MATH :)
3. In Biology, it is found that the bacteria in a certain culture double every half-hour. If the initial number of bacteria in culture is 1000, A. Find the defining equation for the number N of bacteria in culture after T hours, assuming that no bacteria die. B. How many ...
Wednesday, May 4, 2011 at 1:34pm
Biology
Which term describes an organism's ability to maintain a stable internal environment? (1) reproduction (2) extinction (3) locomotion (4) regulation
Tuesday, May 3, 2011 at 7:19pm
Biology
What ethical issues might arise when a drug company funds trials of a new drug it has developed to treat a genetic disorder?
Tuesday, May 3, 2011 at 12:34am
Biology
Habitat limits result in a populations A)salinity B) temperature C) physical obstacles D) biogeographic range
Monday, May 2, 2011 at 11:57pm
biology
What is the typical habitat of a human?
Monday, May 2, 2011 at 11:54pm
biology
could you put the following into order from smallest to largest?? DNA GENE CHROMOSOME
Thursday, April 28, 2011 at 10:17pm
biology
The doubling time of a type of bacteria is 35 minutes. If every bacterium reproduces, then after 35 minutes a population of 64 bacteria will have grown approximately to what size?
Thursday, April 28, 2011 at 12:36pm
Biology
A population of animals has a dominant allele for dark-colored fur and a recessive allele for light-colored fur. If the population of animals is 100 and 12 members of the population have the light-colored fur, about what percentage of the population is heterozygous? What ...
Wednesday, April 27, 2011 at 11:46am
biology
in mushrooms,the basisia are found on the
Monday, April 25, 2011 at 9:58pm
biology
To ensure that the mother will have mature egg cells available for in vitro fertiliazation, she must be treated with chemicals that regulate her reproductive cycle. identify these chemicals tha tregulate the female reproductive cycle. Please help me
Sunday, April 24, 2011 at 10:12pm
Pages: <<Prev | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | Next>>
Post a New Question | Current Questions
For Further Reading