Friday
April 18, 2014

Homework Help: Science: Biology

Recent Homework Questions About Biology

Post a New Question | Current Questions

life sciences
Since Jiskha doesn't have a biology expert at this time, please try posting your question at this site. http://www.biology-online.org/biology-fo​rum/
Thursday, October 10, 2013 at 3:40pm

biology
Which of the following statements is true? 1.Both unicellular and multicellular organisms are at risk of having too much water entering their cells if they are exposed to water containing no salts. 2.Only multicellular organisms have structures that enable them to regulate ...
Thursday, October 10, 2013 at 3:37pm

biology help plz?????????????????
Please tell me which one is TRUE or FALSE for the statements below: 1. During the cardiac cycle the pressure in the left ventricle and right ventricle are approximately equal. 2. During isovolumetric contraction the left ventricular pressure continues to increase and ...
Thursday, October 10, 2013 at 3:28pm

biology help?
Please tell me which one is TRUE or FALSE for the statements below: 1. During the cardiac cycle the pressure in the left ventricle and right ventricle are approximately equal. 2. During isovolumetric contraction the left ventricular pressure continues to increase and ...
Thursday, October 10, 2013 at 7:29am

Human and Social Biology
http://en.wikipedia.org/wiki/Sociobiolog​y
Tuesday, October 8, 2013 at 9:00pm

Human and Social Biology
Describe how social biologist may help to solve the the problems of lack of houses a nd problem ooof sanitation
Tuesday, October 8, 2013 at 8:55pm

Biology simple question
The wavelengths and amplitudes are what it is designed to measure?
Tuesday, October 8, 2013 at 1:43pm

biology
An independent variable is the potential stimulus or cause, usually directly manipulated by the experimenter, so it could also be called a manipulative variable. A dependent variable is the response or measure of results. Extraneous variables — other than the independent ...
Tuesday, October 8, 2013 at 10:52am

biology
5. A researcher finds that blood alcohol levels cause progressive damage to the liver. All the mice in his study were fed the same amount and types of food. Different concentrations of alcohol were injected into each mouse. One group of mice does not receive any alcohol at ...
Tuesday, October 8, 2013 at 10:03am

biology
(1) XA Xa (2) Xa Y (3) Xa Xa (4) XA Y (5) XA Xa (6) XA Y (7) XA Xa (8) XA Xa (9) XA X_ (10) Xa Y (11) Xa Y
Tuesday, October 8, 2013 at 6:50am

Biology simple question
Why is wavelength data important in terms to spectrophotometer. TY SO MUCH!!!
Monday, October 7, 2013 at 6:33pm

Biology
Caenorhabditis elegans hermaphrodites have six different homologous chromosome pairs: five pairs of autosomes (called I-V) and one pair of sex chromosomes (called X). Hermaphrodites can either self-fertilize or they can be fertilized by males (which only have one X chromosome ...
Monday, October 7, 2013 at 4:30pm

biology
Briefly explain how the evolution of the pectoral girdle from the aquatic to the terrestrial environment gave rise to muscle differentiation and specialization in relation to the skull.
Saturday, October 5, 2013 at 6:34pm

Biology of environment poster project
John! You know nothing about Mohammad and whether he needs more help than you do. For a hint -- how many languages do you speak fluently? Please do not comment on other people's posts. It's rude and insulting!
Friday, October 4, 2013 at 5:14pm

Biology of environment poster project
How about you do your own work and leave this site for people who really need help, Mohammad.
Friday, October 4, 2013 at 5:11pm

Biology of environment poster project
Where will you swim? Which fish will you eat?
Friday, October 4, 2013 at 4:24pm

Biology of environment poster project
I think a question type title would get people more hooked
Friday, October 4, 2013 at 4:21pm

Biology of environment poster project
I only want in lake trip but pond must have been dirtier cause it have more algae in it and poster supposed to be comparing the two bodies of water in terms of their biotic and abiotic components and which one is healthier ph of lake was higher there was no fecal colugo em ...
Friday, October 4, 2013 at 3:10pm

Biology of environment poster project
What are a couple of things you noticed about the pond and the lake? Did the pond of scum floating on it?
Friday, October 4, 2013 at 3:03pm

Biology of environment poster project
Ms sue could i make title fun anyhow ? Like so it puts a lot of attention in people ? Pond vs lake can't seem to come with catchy stuff
Friday, October 4, 2013 at 2:57pm

Biology of environment poster project
You're very welcome, Mohammad.
Friday, October 4, 2013 at 2:56pm

Biology of environment poster project
Thanks very much ms sue :)
Friday, October 4, 2013 at 2:53pm

Biology of environment poster project
Ecology of Pond and Lake Biology of Urban Pond and Natural Lake
Friday, October 4, 2013 at 2:49pm

Biology of environment poster project
We went on field trip as class to a pond and lake and we compared the urban pond with natural lake I'm trying to think of title for this study and title has to contain sufficient detail abt what the study is about and the general location of study it should be complete ...
Friday, October 4, 2013 at 2:33pm

biology
No.iii) If you chose "no" above. Which set or sets of individuals is inconsistent with autosomal recessive inheritance? Individuals 10, 11, 12, and 13 iv) If you chose "no" above. Can you change one individual from affected to unaffected and make this ...
Friday, October 4, 2013 at 8:34am

biology
No. iii) If you chose "no" above. Which set or sets of individuals is inconsistent with autosomal dominant inheritance? Individuals 5, 6, 9, 10, and 11 iv) If you chose "no" above. Can you change one individual from unaffected to affected and make this ...
Friday, October 4, 2013 at 7:13am

biology
Yes. (1) XA Xa (2) Xa Y (3) Xa Xa (4) XA Y (5) XA Xa (6) XA Y (7) XA Xa (8) XA Xa (9) XA X_ (10) Xa Y (11) Xa Y ii) If you chose "yes" above. If Individuals 5 and 6 have another son, what is the probability that the boy will be affected by the disease? 0.5
Friday, October 4, 2013 at 6:39am

biology
No. Individuals 1, 2, 3, and 5. AND Individuals 5, 6, 9, 10, and 11..... ...give the number of that individual = 5.
Friday, October 4, 2013 at 6:31am

AP Biology
a, b, c, e, v,d
Tuesday, October 1, 2013 at 8:39pm

AP Biology
a, b, c, e, v,d
Tuesday, October 1, 2013 at 8:39pm

Cam
How is phosphorus evident in estuaries?
Monday, September 30, 2013 at 10:29pm

biology
well my teacher said "draw diagrams for each pyramid and write a summary remember to include the type fold the paper in three parts" so if there is one how come she said 3?
Monday, September 30, 2013 at 6:37pm

biology
one
Monday, September 30, 2013 at 6:35pm

biology
how many pyramids are there?
Monday, September 30, 2013 at 6:34pm

biology
put the pyramid who eats whom? The whom is eaten is at the bottom.
Monday, September 30, 2013 at 6:34pm

biology
http://www.google.com/search?q=pyramid+f​ood+web&rlz=1C1AVSX_enUS414US423&es_sm=1​22&tbm=isch&tbo=u&source=univ&sa=X&ei=Rv​xJUp-OKomK2wWEvoCQCg&ved=0CCkQsAQ&biw=71​1&bih=453&dpr=1
Monday, September 30, 2013 at 6:34pm

biology
explain how a pyramid can be used to show the relationship among the organisms in the food web.
Monday, September 30, 2013 at 6:24pm

biology
Try A.
Monday, September 30, 2013 at 2:05pm

biology
How does mitosis in plant cells differ from that in animal cells? A. Animal cells lack a cell plate. B. Plant cells lack centrioles. C. Plant cells lack spindle fibers. D. Animal cells lack cytokinesis. I chose b but I got it wrong please help....
Monday, September 30, 2013 at 11:14am

Biology
sucrose
Sunday, September 29, 2013 at 8:25pm

Biology
Glucose + Fructose=__________________. I am thinking it is sucrose or table sugar but I am not sure.
Sunday, September 29, 2013 at 6:32pm

biology
The importance of carbon's ability to form covalent bonds in straight chains is because of isomers. Carbon assists the molecules in isomers because they are compounds with a similar chemical formula but with a different shape.
Sunday, September 29, 2013 at 12:31pm

Biology of the environment term
Are you sure you understood the teacher correctly? I believe that a limiting factor causes the population to decrease. http://en.wikipedia.org/wiki/Limiting_fa​ctor Too much or too little phosphorus or nitrogen can be limiting factors.
Friday, September 27, 2013 at 5:26pm

Biology of the environment term
Teacher explained to us what limiting factor was but I'm not able to understand she said that a limiting factor causes increase in population but I not get how and why is called limiting factor than ? She also said how Phodphorus and nitrogen were limiting nutrients ?
Friday, September 27, 2013 at 5:02pm

biology
An independent variable is the potential stimulus or cause, usually directly manipulated by the experimenter, so it could also be called a manipulative variable. A dependent variable is the response or measure of results.
Friday, September 27, 2013 at 1:06pm

Biology
Since this is not my area of expertise, I searched Google under the key words "taxonomic nomenclature" to get these possible sources: https://www.google.com/search?client=saf​ari&rls=en&q=taxonomic+nomenclature&ie=U​TF-8&oe=UTF-8 In the future, you can ...
Friday, September 27, 2013 at 12:37pm

Biology
what is taxonomic nomenclature?
Friday, September 27, 2013 at 11:33am

biology
This is a Independent and Dependent Variable questions. If leaf color change is related to temperature, then exposing plants to low temperatures will result in changes in leaf color.
Thursday, September 26, 2013 at 9:19pm

Biology
Carbohydrates
Wednesday, September 25, 2013 at 8:00pm

biology
What type of monomer does ATP represent?
Wednesday, September 25, 2013 at 6:35pm

biology
We cannot draw on these posts.
Wednesday, September 25, 2013 at 12:55pm

biology
The sequence below begins with the initiator methione. ATGTTCAATGTTATGGATTGGCCCTGGTAAATGAAATAGA​ATGAT Please give a hypothetical (translation of cDNA sequence into single amino acid codes if there is a C deletion in the phenylalanine codon _4pts.(Please give a ...
Tuesday, September 24, 2013 at 11:41pm

biology
4pts((all(or(none): Q1:(Draw(a(gene(with(three(exons(on(the(​line(below. The(coding(region((ORF) is(completely(contained(in(the(second(ex​on. Make(sure(you(annotate(the(following(reg​ions: TSS 5’UTR(all(regions) Coding(sequence 3’UTR(all(regions) ...
Tuesday, September 24, 2013 at 11:40pm

AP Biology- Molecular Genetics
Q2:(The(sequence(below(begins(with(the(i​nitiator(methione. ATG(TTC(AAT(GTT(ATG(GAT(TGG(CCC(TGG(TAA(​ATG(AAA(TAGAATGAT 4pts.(Please(give(a(hypothetical(transla​tion(of((cDNA(sequence(into(single( amino(acid(codes(if(there(is(a(C(deletio​n(in(the(...
Tuesday, September 24, 2013 at 11:27pm

Biology of Environment
Complex systems have multiple sub systems, what would be example of this? A tree?
Tuesday, September 24, 2013 at 4:19pm

biology 111 a& p Bccc
how can you recognize carbohydrate from a list of biological molecules?
Monday, September 23, 2013 at 3:56pm

biology 111 a& p
how can you recognize carbohydrate from a list of biological molecules?
Monday, September 23, 2013 at 3:49pm

Biology
Suppose 1.00 ml of blood from a given donor contained 5 X 106 red blood cells and the donor’s hematocrit were 48%. Determine the surface area that the lipids extracted from the plasma membranes of red blood cells obtained from 10.0 ml blood would occupy on the surface of ...
Sunday, September 22, 2013 at 9:44pm

biology
I need to know how egg whites would react when tested in iodine and Benedict's solution.
Sunday, September 22, 2013 at 9:14pm

Biology
False
Sunday, September 22, 2013 at 4:13pm

Cell Biology
Suppose 1.00 ml of blood from a given donor contained 5 X 106 red blood cells and the donor’s hematocrit were 48%. Determine the surface area that the lipids extracted from the plasma membranes of red blood cells obtained from 10.0 ml blood would occupy on the surface of ...
Saturday, September 21, 2013 at 10:17pm

Biology
Enantiomers, like L-alanine and D-alanine, are so similar that ribosomes will incorporate either one into a protein during synthesis. True or False?
Saturday, September 21, 2013 at 5:36pm

science-biology
what do cells do?
Friday, September 20, 2013 at 3:33pm

Biology
your answer are right i just used them.
Friday, September 20, 2013 at 2:22pm

biology
The relative number is going to be 250 times greater for glucose than albumin, given that the number of grams of each substance in the solution is the same . 45000/ 180= 250
Wednesday, September 18, 2013 at 11:12pm

Biology
You're welcome. :-)
Tuesday, September 17, 2013 at 4:40pm

Biology
It was C....that was my gut instinct also...thanks
Tuesday, September 17, 2013 at 4:09pm

Biology
I vote for C.
Tuesday, September 17, 2013 at 3:05pm

Biology
Which is one way that a freshwater wetland differs from a lake or pond? A. water flows in a lake or pond but never flows in a wetland. B. Wetlands are nesting areas for birds, but lakes and ponds are not. C. Water does not always cover a wetland as it does a lake or pond. D. ...
Tuesday, September 17, 2013 at 2:26pm

BIOLOGY
yes, no, yes is correct
Tuesday, September 17, 2013 at 4:21am

BIOLOGY
yes to hydrogen bond no to ionic bond yes van der Waals bond
Monday, September 16, 2013 at 9:35pm

biology
Please note: The Connection Academy Networking team has this question and website page added to our logs. Answering this question or use of this question and/or it's answers in a QuickCheck, Quiz, or Test, WILL result in a ZERO or notification of the principal for your ...
Monday, September 16, 2013 at 3:08pm

biology
Arteries take blood from the heart, while veins bring blood back to the heart. Because of this their construction differs. Since this is not my area of expertise, I searched Google under the key words "veins vs. arteries" to get these possible sources: https://www....
Monday, September 16, 2013 at 2:52pm

biology
1.Briefly explain the evolution of limb orientation and the effects of limb posture on support and locomotion. 2.The transition from the aquatic to the terrestrial environment resulted in what kind of evolutionary changes in the girdles of tetrapods? Why might these changes be...
Monday, September 16, 2013 at 11:06am

biology
ya'll nuts
Monday, September 16, 2013 at 10:05am

biology
what are the differences between a vein and an artery? Give your answer with reference to specific examples. I don't know how to refer to specific examples...please help me..
Sunday, September 15, 2013 at 11:21pm

physics
answer biology for satyajit !!!He is my student, if you shall not answer then my 200 students' participation on jiskha will be banned!!!I shall refuse them to ask you questions !We can find a plenty sites like you!
Sunday, September 15, 2013 at 9:46am

biology
Question: How many hydrogens are in this image? Image: oi43.tinypic[dot]com/2hxwql1.jpg (Replace [dot] with a period (.)) Oiriginal Question: (A) Enter the formula for Tamiflu by typing the number of each atom in the blanks. If Tamiflu does not contain any atoms of that ...
Sunday, September 15, 2013 at 8:17am

biology
A person(between 11-17) gets up and goes somewhere after sitting 20 mins in a place then he stops at a place for his work but a blackish region surrounds his face for 5secs and he falls on the ground ?after 10secs he feels that now his brain is ok and he gets up but with a ...
Saturday, September 14, 2013 at 11:00pm

math
(a) 0, since there are still 30 students in neither class. Only if the two classes sum to more than 150 does it mean that someone is taking both. (b) 30, since that would mean that ALL the biology students are also taking algebra (c) 60, since if all 30 biology students were ...
Saturday, September 14, 2013 at 4:00pm

math
In a survey of 150 students, 90 were taking algebra, and 30 taking biology. a. what is the least number of students who could have been taking both classes? b. what is the greatest number of students who could be taking both courses? c. what is the greatest number of student ...
Saturday, September 14, 2013 at 2:54pm

BIOLOGY
Yes, yes, no
Saturday, September 14, 2013 at 12:08pm

biology need help
I need help with nutrition topic
Saturday, September 14, 2013 at 11:54am

biology need help
You're welcome.
Friday, September 13, 2013 at 8:36pm

biology need help
ok thank you
Friday, September 13, 2013 at 8:33pm

biology need help
I think community is your answer. Please study the websites I posted for you.
Friday, September 13, 2013 at 8:25pm

biology need help
it says all of the population in a give area and i have to find what it is. and for ecosystem i need to describe it and give ex
Friday, September 13, 2013 at 8:11pm

biology need help
It's a poorly worded question, since three of us believed it was ecosystem. However, check this site. http://animals.about.com/od/zoologybasic​s/a/communitiesecosystems.htm
Friday, September 13, 2013 at 8:08pm

biology need help
but on the wkst ecosystem is already there i was thinking community
Friday, September 13, 2013 at 8:04pm

biology need help
Yeah it's ecosystem.
Friday, September 13, 2013 at 7:57pm

biology need help
http://forest.mtu.edu/kidscorner/ecosyst​ems/definition.html http://www.geography.learnontheinternet.​co.uk/topics/ecosystem.html http://www.google.com/search?q=ecosystem​s+examples&tbm=isch&tbo=u&source=univ&sa​=X&ei=AqYzUuTwPMeErQHl4IHACg&sqi=2&ved=0...
Friday, September 13, 2013 at 7:57pm

biology need help
Hmmmm. I suspect you are looking for ecosystem: all the interacting populations in a given area. examples? google ecosystems
Friday, September 13, 2013 at 7:53pm

biology need help
what word is the definition of "all of the populations in a given area." and some examples
Friday, September 13, 2013 at 7:50pm

Biology ms sue
You're very welcome, Mohammad.
Friday, September 13, 2013 at 7:31pm

Biology ms sue
Thanks so much ms sue :)
Friday, September 13, 2013 at 7:31pm

Biology ms sue
When people around us respect the environment, we usually do too. People I know recycle paper, cans, plastic, etc. We buy cloth bags for our groceries. We'd be embarrassed to litter or harm nature. The environment influences culture. As I understand it, Islamic paradise is...
Friday, September 13, 2013 at 7:14pm

Biology ms sue
Thanks very much ms sue can you please help me to put this in better explained detailed answer ? One point I got for culture is that ones beliefs and customs can affect environment what other points can I add for both ?
Friday, September 13, 2013 at 6:54pm

Biology ms sue
Yes, I agree. Environmental ethics and cultural ethics definitely influence each other.
Friday, September 13, 2013 at 6:52pm

Biology ms sue
Hi ms sue you had answerd question abt whether culture ethic have influence over environmental ethics or vice Versa could it be that both have effect over each other ? Why only culture have effect over it ? Cause do environmental ethics change way we perceive environment ?
Friday, September 13, 2013 at 6:48pm

chemistry---Biology 101
Not much to go on here. Several words might fit in those blanks. When we say an atom has an incomplete outer shell, this means the atom has __"too few"____________________ electrons in its outermost shell. Atoms that have incomplete outer shells usually seek to fill ...
Friday, September 13, 2013 at 4:15pm

Pages: <<Prev | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | Next>>

Post a New Question | Current Questions

Homework Help: Science

Search
Members