Wednesday
October 22, 2014

Homework Help: Science: Biology

Recent Homework Questions About Biology

Post a New Question | Current Questions

Biology of environment
What does dynamic equlibrium population growth mean?
Saturday, October 12, 2013 at 1:28pm

Biology
If a person has a herniated disk, sometime surgery can relive the pain that is associated with the condition. One side effect can be a loss of spinal flexibility. Why does this occur?
Friday, October 11, 2013 at 3:12pm

Biology
If a person has a herniated disk, sometime surgery can relive the pain that is associated with the condition. One side effect can be a loss of spinal flexibility. Why does this occur?
Friday, October 11, 2013 at 1:13pm

Biology
After adolescence, bones stop growing longer. They do however continue to grow. How do bones remodel and undergo repair
Friday, October 11, 2013 at 12:11pm

Biology
You wish to produce a human enzyme, protein A, by introducing its gene into bacteria. The genetically engineered bacteria make large amounts of protein A, but it is in the form of an insoluble aggregate with no enzymatic activity. Which of the following procedures might help ...
Thursday, October 10, 2013 at 10:42pm

biology
Which of the following statements is true? 1.Both unicellular and multicellular organisms are at risk of having too much water entering their cells if they are exposed to water containing no salts. 2.Only multicellular organisms have structures that enable them to regulate ...
Thursday, October 10, 2013 at 3:37pm

biology help plz?????????????????
Please tell me which one is TRUE or FALSE for the statements below: 1. During the cardiac cycle the pressure in the left ventricle and right ventricle are approximately equal. 2. During isovolumetric contraction the left ventricular pressure continues to increase and ...
Thursday, October 10, 2013 at 3:28pm

biology help?
Please tell me which one is TRUE or FALSE for the statements below: 1. During the cardiac cycle the pressure in the left ventricle and right ventricle are approximately equal. 2. During isovolumetric contraction the left ventricular pressure continues to increase and ...
Thursday, October 10, 2013 at 7:29am

Human and Social Biology
Describe how social biologist may help to solve the the problems of lack of houses a nd problem ooof sanitation
Tuesday, October 8, 2013 at 8:55pm

biology
5. A researcher finds that blood alcohol levels cause progressive damage to the liver. All the mice in his study were fed the same amount and types of food. Different concentrations of alcohol were injected into each mouse. One group of mice does not receive any alcohol at ...
Tuesday, October 8, 2013 at 10:03am

Biology simple question
Why is wavelength data important in terms to spectrophotometer. TY SO MUCH!!!
Monday, October 7, 2013 at 6:33pm

Biology
Caenorhabditis elegans hermaphrodites have six different homologous chromosome pairs: five pairs of autosomes (called I-V) and one pair of sex chromosomes (called X). Hermaphrodites can either self-fertilize or they can be fertilized by males (which only have one X chromosome ...
Monday, October 7, 2013 at 4:30pm

biology
Briefly explain how the evolution of the pectoral girdle from the aquatic to the terrestrial environment gave rise to muscle differentiation and specialization in relation to the skull.
Saturday, October 5, 2013 at 6:34pm

Biology of environment poster project
We went on field trip as class to a pond and lake and we compared the urban pond with natural lake I'm trying to think of title for this study and title has to contain sufficient detail abt what the study is about and the general location of study it should be complete ...
Friday, October 4, 2013 at 2:33pm

biology
explain how a pyramid can be used to show the relationship among the organisms in the food web.
Monday, September 30, 2013 at 6:24pm

biology
How does mitosis in plant cells differ from that in animal cells? A. Animal cells lack a cell plate. B. Plant cells lack centrioles. C. Plant cells lack spindle fibers. D. Animal cells lack cytokinesis. I chose b but I got it wrong please help....
Monday, September 30, 2013 at 11:14am

Biology
Glucose + Fructose=__________________. I am thinking it is sucrose or table sugar but I am not sure.
Sunday, September 29, 2013 at 6:32pm

Biology of the environment term
Teacher explained to us what limiting factor was but I'm not able to understand she said that a limiting factor causes increase in population but I not get how and why is called limiting factor than ? She also said how Phodphorus and nitrogen were limiting nutrients ?
Friday, September 27, 2013 at 5:02pm

Biology
what is taxonomic nomenclature?
Friday, September 27, 2013 at 11:33am

biology
This is a Independent and Dependent Variable questions. If leaf color change is related to temperature, then exposing plants to low temperatures will result in changes in leaf color.
Thursday, September 26, 2013 at 9:19pm

biology
What type of monomer does ATP represent?
Wednesday, September 25, 2013 at 6:35pm

biology
The sequence below begins with the initiator methione. ATGTTCAATGTTATGGATTGGCCCTGGTAAATGAAATAGA​ATGAT Please give a hypothetical (translation of cDNA sequence into single amino acid codes if there is a C deletion in the phenylalanine codon _4pts.(Please give a ...
Tuesday, September 24, 2013 at 11:41pm

biology
4pts((all(or(none): Q1:(Draw(a(gene(with(three(exons(on(the(​line(below. The(coding(region((ORF) is(completely(contained(in(the(second(ex​on. Make(sure(you(annotate(the(following(reg​ions: TSS 5’UTR(all(regions) Coding(sequence 3’UTR(all(regions) ...
Tuesday, September 24, 2013 at 11:40pm

Biology of Environment
Complex systems have multiple sub systems, what would be example of this? A tree?
Tuesday, September 24, 2013 at 4:19pm

Biology
Suppose 1.00 ml of blood from a given donor contained 5 X 106 red blood cells and the donor’s hematocrit were 48%. Determine the surface area that the lipids extracted from the plasma membranes of red blood cells obtained from 10.0 ml blood would occupy on the surface of ...
Sunday, September 22, 2013 at 9:44pm

biology
I need to know how egg whites would react when tested in iodine and Benedict's solution.
Sunday, September 22, 2013 at 9:14pm

Cell Biology
Suppose 1.00 ml of blood from a given donor contained 5 X 106 red blood cells and the donor’s hematocrit were 48%. Determine the surface area that the lipids extracted from the plasma membranes of red blood cells obtained from 10.0 ml blood would occupy on the surface of ...
Saturday, September 21, 2013 at 10:17pm

Biology
Enantiomers, like L-alanine and D-alanine, are so similar that ribosomes will incorporate either one into a protein during synthesis. True or False?
Saturday, September 21, 2013 at 5:36pm

Biology
Which is one way that a freshwater wetland differs from a lake or pond? A. water flows in a lake or pond but never flows in a wetland. B. Wetlands are nesting areas for birds, but lakes and ponds are not. C. Water does not always cover a wetland as it does a lake or pond. D. ...
Tuesday, September 17, 2013 at 2:26pm

biology
1.Briefly explain the evolution of limb orientation and the effects of limb posture on support and locomotion. 2.The transition from the aquatic to the terrestrial environment resulted in what kind of evolutionary changes in the girdles of tetrapods? Why might these changes be...
Monday, September 16, 2013 at 11:06am

biology
what are the differences between a vein and an artery? Give your answer with reference to specific examples. I don't know how to refer to specific examples...please help me..
Sunday, September 15, 2013 at 11:21pm

biology
Question: How many hydrogens are in this image? Image: oi43.tinypic[dot]com/2hxwql1.jpg (Replace [dot] with a period (.)) Oiriginal Question: (A) Enter the formula for Tamiflu by typing the number of each atom in the blanks. If Tamiflu does not contain any atoms of that ...
Sunday, September 15, 2013 at 8:17am

biology
A person(between 11-17) gets up and goes somewhere after sitting 20 mins in a place then he stops at a place for his work but a blackish region surrounds his face for 5secs and he falls on the ground ?after 10secs he feels that now his brain is ok and he gets up but with a ...
Saturday, September 14, 2013 at 11:00pm

math
In a survey of 150 students, 90 were taking algebra, and 30 taking biology. a. what is the least number of students who could have been taking both classes? b. what is the greatest number of students who could be taking both courses? c. what is the greatest number of student ...
Saturday, September 14, 2013 at 2:54pm

biology need help
what word is the definition of "all of the populations in a given area." and some examples
Friday, September 13, 2013 at 7:50pm

Biology ms sue
Hi ms sue you had answerd question abt whether culture ethic have influence over environmental ethics or vice Versa could it be that both have effect over each other ? Why only culture have effect over it ? Cause do environmental ethics change way we perceive environment ?
Friday, September 13, 2013 at 6:48pm

Biology 101
When we say an atom has an incomplete outer shell, this means the atom has ______________________ electrons in its outermost shell. Atoms that have incomplete outer shells usually seek to fill their shells by forming ____________________ ________________ through the sharing or...
Friday, September 13, 2013 at 4:01pm

math
In a class of 60 student,the number of student who passed biology is 6 more than the number of student who passed chemistry.Every student passed atleast one of the two subject and 85 student passed both subjects
Thursday, September 12, 2013 at 10:33pm

need help biology
is a community the population in a given area or is that an ecosystem and give ex
Thursday, September 12, 2013 at 5:19pm

Biology of environment
5 factors that influence persons attitude towards environment and how this relate to their own worldview I got media, education and social habits which others ?
Thursday, September 12, 2013 at 12:39pm

Biology of environment
I have to define what these words mean culture and environmental ethics and which one have influence over other For culture I just wrote that its beliefs and customs that are shared of group of people anything to add to that and I don't get what environmental ethic means ...
Thursday, September 12, 2013 at 12:37pm

Biology of environment
I don't get what these words mean can someone please simplify so I understand thank you !! Anthropocentric Biocentric Ecocentric
Thursday, September 12, 2013 at 12:35pm

BIOLOGY
Can TAMIFLU form a hydrogen bond with another molecule? Can TAMIFLU form a ionic bond with another molecule? Can TAMIFLU form a van der Waals forces bond with another molecule?
Thursday, September 12, 2013 at 8:16am

biology
what is a descriptive title for an experiment consisting of how alka seltzer dissolves if one is crushed and the other one is whole in warm and cold water?
Wednesday, September 11, 2013 at 5:53pm

Biology
Give two examples of each classes of phylum mullusca?
Wednesday, September 11, 2013 at 10:22am

Biology
What is torism? How do echinodermata digest larger prey out side their body?
Wednesday, September 11, 2013 at 10:18am

biology
concentration of methyl mercury in fish and number of meals safely consumed per month which is the dependent and independent does the dependent go on the y or x-axis
Tuesday, September 10, 2013 at 6:15am

biology
3.68kg=____________g
Monday, September 9, 2013 at 3:53pm

Biology
By what process are molecules absorbed into the large intestine?
Monday, September 9, 2013 at 9:16am

biology
Pseudoscience and nonscience differ in that:
Saturday, September 7, 2013 at 4:24pm

biology
Methyl mercury is a toxic substance that can harm the nervous system. Some fish are contaminated with high levels of methyl mercury. In many places, these fish are an important food source. Experiments are being conducted to determine how many meals of contaminated fish can be...
Friday, September 6, 2013 at 6:07pm

biology
Smithers thinks that a special juice will increase the productivity of workers. He creates two groups of 50 workers each and assigns each group the same task (in this case, they're supposed to staple a set of papers). Group A is given the special juice to drink while they ...
Thursday, September 5, 2013 at 10:20am

biology
You need a 5 microgram glucose/ml aqueous solution, but the lab balance is accurate to only 0.01g (ie., it displays 2 digits to the right of the decimal point) Describe 2 methods by which you could accurately prepare this solution using the lab balance. I don't know what ...
Wednesday, September 4, 2013 at 2:56pm

Biology
Which of the following is a correct statement? A. Decomposition is an important part of only two of the three nutrient cycles. B. The nutrient cycles contain paths of elements through the living world but not through the nonliving world. C. Living organisms are able to convert...
Wednesday, September 4, 2013 at 12:38pm

Science/ biology PLEASE HELP!
Pick the correct answer to the following question. Write a brief statement explaining why each choice of answers is correct or incorrect. In diabetes mellitus, because of insufficient insulin production, glucose cannot enter cells. instead it accumulates in the blood plasma. ...
Tuesday, September 3, 2013 at 3:51pm

Science/Biology
Pick the correct answer to the following question. Write a brief statement explaining why each choice of answers is correct or incorrect. In diabetes mellitus, because of insufficient insulin production, glucose cannot enter cells. instead it accumulates in the blood plasma. ...
Tuesday, September 3, 2013 at 1:49pm

URGENT Science question
Justin wants to be the captain of an aircraft carrier when he gets out of school. Which subjects should Justin study to help him prepare for this career? biomedical science and meteorology oceanography and paleontology chemistry and biology physics and computer science*** Am I...
Tuesday, September 3, 2013 at 1:03pm

Please Help Biology Question
Pick the correct answer to the following question. Write a brief statement explaining why each choice of answers is correct or incorrect. In diabetes mellitus, because of insufficient insulin production, glucose cannot enter cells. instead it accumulates in the blood plasma. ...
Tuesday, September 3, 2013 at 12:20pm

Biology (Please Help: Urgent)
The Hardy-Weinberg formulas allow scientists to determine whether evolution has occurred. Any changes in the gene frequencies in the population over time can be detected. The law essentially states that if no evolution is occurring, then an equilibrium of allele frequencies ...
Friday, August 30, 2013 at 8:37am

Biology
Pick the correct answer to the following question. Write a brief statement explaining why each choice of answers is correct or incorrect. In diabetes mellitus, because of insufficient insulin production, glucose cannot enter cells. instead it accumulates in rhe blood plasma. ...
Wednesday, August 28, 2013 at 4:05pm

Biology
Which of the following is true? A.Biased thinking promotes scientific ideas. B.Open-mindedness restricts scientific thinking. C. Creativity fosters scientific discovery. D. Skepticism inhibits scientific exploration. I think it is C...?
Wednesday, August 28, 2013 at 10:39am

Biology
Describe how enzymes affect chemical reactions and explain why this makes enzymes important to living things. I need help this will be on my test I am studying for.
Wednesday, August 28, 2013 at 10:38am

Biology
Amino acid is to protein as A. fat is to lipid B. DNA is to RNA C. sugar is to fat D. simple sugar is to cellulose I think it is A..?
Wednesday, August 28, 2013 at 10:04am

Biology
You are testing a hypothesis that population density of a particular plant species influences the rate at which a pathogenic fungus infects the plant. Because the fungus causes visible scars on the leaves, you can easily determine whether a plant is infected. Design an ...
Monday, August 26, 2013 at 12:24pm

biology
Does each sister chromatid contain double stranded DNA?
Sunday, August 25, 2013 at 7:36pm

Biology
What does the notation 4n = 28 tell you about how many types of chromosomes there are and how many of each type of chromosome are present in a cell? I am a little confused on how this is determined. Would it be 4 sets of chromosomes with 7 of each type of chromosome?
Saturday, August 24, 2013 at 11:17pm

Biology
1. Given the following concordance rates, is the identified trait primarily genetic or environmental? Explain. MZ Twins DZ Twins Height 0.94 0.44 Measles 0.95 0.87 Migraine headaches 0.80 0.39 Body fat percentage 0.73 0.22
Thursday, August 22, 2013 at 4:38pm

Biology
The intracellular fluid concentration is 300 mOsm/kg. The extracellular fluid concentration is 280 mOsm/kg. The net movement of water is in which direction?
Wednesday, August 21, 2013 at 4:14pm

Biology
The intracellular fluid concentration is 300 mOsm/kg. The extracellular fluid concentration is 280 mOsm/kg. The net movement of water is in which direction?
Wednesday, August 21, 2013 at 4:13pm

Biology (Science)
Which of the following is not true about a hypothesis? 1) Previous knowledge can help support it. 2) It is a tentative explanation. 3) It can be proven to be false. 4) It must be testable to be useful. 5) It can be proven to be true. I know for sure that 2 and 4 is not the ...
Wednesday, August 21, 2013 at 2:28pm

Biology (Science)
John uses mechanical "predators" to approach frogs at a pond shore, and he records the distance between predator and frog as the frogs jump. (PEER REVIEW) On a walk around pond John sees that small frogs on the shore only allow him to get within 5 feet before jumping...
Wednesday, August 21, 2013 at 1:15pm

Biology
Draw a Punnett square to demonstrate the inheritance of cystic fibrosis with both parents being carriers
Tuesday, August 20, 2013 at 7:20pm

biology
which of the following properties of water would be most important in protecting a fish in a shallow pond on a hot summer day?
Tuesday, August 20, 2013 at 1:08pm

BiologyI
Discoveries in DNA, cell biology, evolution, biotechnology have been among the major achievements in biology over the past 200 years with accelerated discoveries and insights over the last 50 years. Consider the progress we have made in these areas of human knowledge. Present ...
Monday, August 19, 2013 at 2:20pm

Biology
The father of a mating pair expresses Huntington disease. The mother is healthy. What is the recurrence risk for the offspring? Draw a Punnett square to demonstrate the inheritance.
Sunday, August 18, 2013 at 9:09pm

Biology
Which of the following statements about the compound HCl is true? *The physical and chemical properties of HCl are different from those of H2 and Cl2. *Only the physical properties of HCl are different from those of H2 and Cl2. *Only the chemical properties of HCl are ...
Thursday, August 15, 2013 at 5:07pm

biology
identify and describe how organism could respond to an external stimulus
Wednesday, August 14, 2013 at 2:27pm

Biology please help
1. Contraction of the diaphragm causes: A. a person to exhale. B. the size of the chest cavity to increase. C. air to flow from the lungs to the outside. D. compression of the lungs. is it B 2. The function of the large intestine is to: A. supply enzymes for digestion. B. ...
Saturday, August 10, 2013 at 11:59am

Biology
1. Muscles are grouped in antagonistic sets because: A. muscles cannot lengthen by themselves. B. muscles push but cannot pull. C. they do not like one another. D. there is an increase in metabolic efficiency if they are present in antagonistic sets. is it A 2. In most women&#...
Saturday, August 10, 2013 at 11:47am

Biology
1. Contraction of the diaphragm causes: A. a person to exhale. B. the size of the chest cavity to increase. C. air to flow from the lungs to the outside. D. compression of the lungs. is it B 2. The function of the large intestine is to: A. supply enzymes for digestion. B. ...
Saturday, August 10, 2013 at 10:39am

Biology
1. Unprotected seeds are found in: A. cones. B. perfect flowers. C. imperfect flowers. D. fruit. im confused between A n D 2. The most harmful parasite for plants and animals is the: A. roundworm. B. protozoan. C. fungus. D. flatworm. is it A 3. Benthic organisms are found: A...
Tuesday, August 6, 2013 at 1:51pm

biology- photosynthesis
There is a distinct oscillation of CO2 during each year as CO2 is added to the atmosphere each winter or removed from the atmosphere each summer. Explain what specific cellular processes lead to these changes in CO2 level. You must explain what causes CO2 to be released to the...
Tuesday, August 6, 2013 at 8:51am

biology
Explain how new species can originate without geographical barriers.
Thursday, August 1, 2013 at 3:48pm

biology
In a laboratory population of diploid, sexually reproducing organisms a certain trait is determined by a single autosomal gene and is expressed as two phenotypes. A new population was created by crossing 102 pure–breeding (homozygous) dominant individuals with 98 pure ...
Thursday, August 1, 2013 at 2:48pm

biology
In a population that is in Hardy–Weinberg equilibrium for two alleles, C and c, 16% of the population shows a recessive trait. Assuming C is dominant to c, state the percent of the population shows the dominant trait? Show your work. Thank you!
Thursday, August 1, 2013 at 2:00pm

biology
In a population with two alleles, B and b, and the allele frequency of b is 0.4. Calculate the allele frequency of heterozygotes if the population is in Hardy–Weinberg equilibrium? Show your work. Thanks for any help in advance!
Thursday, August 1, 2013 at 12:20pm

biology multiple choice
I am preparing my self for a biology exam and i am going through past papers. Unfortunately they do not supply us with the answers, which in one way is good.(since you have to actually work for your answers) All I am asking of you people is that you run over my answers and see...
Thursday, August 1, 2013 at 6:13am

biology
Why all enzyme work well in their own optimum temperature and optimum pH ? i need more explanation about why different enzyme have different optimum temperature and different optimum pH to react. i hope to get a long explanation for my essay that contain 5 marks.
Wednesday, July 31, 2013 at 11:22am

Biology
Which of the following best predicts the response of a trait to artificial selection? VA VG standard deviation h2 H2
Wednesday, July 31, 2013 at 12:46am

biology
Do all enzymes function within the different temperature range, like they do with pH?
Monday, July 29, 2013 at 4:21pm

biology
Post a 200- to 300-word response to the following: Many studies have been conducted on cerebral lateralization revealing different functionalities of the left and right hemispheres. Describe four methods for studying cerebral lateralization.
Thursday, July 25, 2013 at 3:31pm

biology
Properties of life and recognizing living and nonliving things What does it take to be a living organism
Thursday, July 25, 2013 at 12:09pm

Biology
Is there any biology websites for teens??? (NOT games! notes and quizzes to practice). The Science of Biology The Chemistry of Life Cell Structure and Function Photosynthesis & Respiration Something REALLY easy to understand(btw I'm going to the 9TH GRADE). please help (...
Wednesday, July 17, 2013 at 6:01pm

biology
This question consisted of a pedigree which involves certain inbred individuals which you are going to identify. The inbred coefficient is for one of the first cousins named Stormy is F = 0.08. An individual called Shady is a parent. Question: Is Shady inbred? How did you ...
Sunday, July 14, 2013 at 7:39pm

biology
Certain spider toxins work by inhibiting Ca2+ channels. Briefly explain how this works and what happens to the person.
Saturday, July 13, 2013 at 6:36pm

biology
1. Enzyme competition occurs when: A. one type of enzyme reacts with one type of substrate. B. an enzyme does not react with a substrate. C. three different types of enzymes react with one type of substrate. D. an enzyme stops a reaction. is it C 2. The proton pump is ...
Saturday, July 13, 2013 at 3:13pm

Biology
1. Some people get repeated fungal infections because they cannot destroy these dangerous microbes after their white blood cells phagocytize them. This most likely means that these people have __________ that do not work properly. A. ribosomes B. lysosomes C. mitochondria D. ...
Saturday, July 13, 2013 at 2:59pm

Biology
Will you please check my answers? 1. Single-celled organisms that do not have a membrane-bound nucleus are called A. organelles. B. prokaryotes. C. Golgi bodies. D. eukaryotes. 2. In cells, a form of active transport is A. a sodium-potassium pump. B. osmosis. C. facilitated ...
Friday, July 12, 2013 at 6:40pm

Biology
Which is NOT a major function of proteins? A. Provides cell structure B. Stores energy for the cell C. Functions as regulator molecules in cellular activity D. Functions as carrier molecules is it D
Wednesday, July 10, 2013 at 3:38pm

Biology
1. A theory and a hypothesis are different in that: A. you must have a theory before you can form a hypothesis. B. a theory is developed as a result of broad agreement among scientists and a hypothesis is a much less substantiated idea. C. a theory is much easier to disprove ...
Wednesday, July 10, 2013 at 3:28pm

Pages: <<Prev | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | Next>>

Post a New Question | Current Questions

Homework Help: Science

Search
Members