April 26, 2015

Homework Help: Science: Biology

Recent Homework Questions About Biology

Put the following in the correct order. Report results Determine if hypothesis is true Do background research Construct a hypothesis Collect data Analyze results and draw conclusions Design and implement an experiment State the problem / ask questions Correct Order State the ...
Tuesday, September 16, 2014 at 7:31pm

Explain the role of a hypothesis in a scientific investigation
Tuesday, September 16, 2014 at 11:34am

In terms of energy, what is the difference between glucose and ATP?
Tuesday, September 16, 2014 at 11:24am

The function of a protein is determined by its ? Answer: shape The shape of a protein is determined by the ? of its ? ? First answer : ? Second two answers : primary structure
Monday, September 15, 2014 at 11:25pm

How are the hydrogen bonds broken during DNA replication? Is it done by the DNA polymerases?
Monday, September 15, 2014 at 6:51pm

A Biology student wants to know if Mountain Dew will make plants grow faster than water. As a Chemistry student, you have agreed to assist in the planning of the experiment to make sure the student designs a valid experiment. 1) What is the experimental question? 2) What is ...
Monday, September 15, 2014 at 3:33pm

Are a replication fork and an origin of replication the same thing?
Monday, September 15, 2014 at 3:14pm

Discribe in details how archaeopteryz sp.was fossilized?
Sunday, September 14, 2014 at 2:05pm

Describe how you would prepare 90 mL of a 5 mM NaCl solution from a 2 M NaCl stock solution. Describe your actions–exactly what you would do –step-by-step–when preparing this solution. Also show all calculations. Be sure all amounts include units of measurement.
Sunday, September 14, 2014 at 12:46am

A student wishes to prepare 300 mL of 0.25 M sucrose. He puts 25.7 g of sucrose in a beaker and then adds 300 mL of dH2O. The total volume of the solution after the sucrose has been dissolved is 330 mL. a) What did he do wrong when preparing his solution? b) What is the actual...
Sunday, September 14, 2014 at 12:44am

A company seeks to develop an herbicide that kills plants by directly interfering (at the cellular level) with plants’ ability to maintain turgor pressure. An herbicide could accomplish this by disrupting the membrane of _____.
Friday, September 12, 2014 at 2:22pm

A hydrogen ion is the same as a proton true or fasle
Friday, September 12, 2014 at 1:16pm

Breaking the hydrogen bond between two water molecules is called dissociation. true or false
Friday, September 12, 2014 at 1:15pm

What is a reactant that binds to a catalyst? Answer: a catalyst An enzyme is a kind of ? Answer: a substrate
Thursday, September 11, 2014 at 7:33pm

What is a reactant that binds to a catalyst? Answer: a catalyst An enzyme is a kind of what? Answer: a substrate
Thursday, September 11, 2014 at 7:12pm

Science - Please Check My Four Answers
Please help me with the following questions: 1. Which is usually the best way to present or communicate inferred data? A. in a bar graph B. in a data table C. in a simple diagram D. in a written paragraph I know the answer isn't C or D(I got C wrong), but now I think the ...
Thursday, September 11, 2014 at 5:43pm

Science - Please Check My Answers
Please help me with the following: Which is usually the best way to present or communicate inferred data? A. in a bar graph B. in a data table C. in a simple diagram D. in a written paragraph I know the answer isn't C or D(I got C wrong), but now I think the answer is B. ...
Thursday, September 11, 2014 at 3:52pm

why do potatoes and onions have reducing sugar present
Thursday, September 11, 2014 at 2:36pm

why do potatoes and onions have reducing sugar present.
Thursday, September 11, 2014 at 2:34pm

jordan is doing a science fair project on the effect of music on the growth of tomatoes. he has two tomato plants, plant A and B, that he grows in a window and gives the same amount of water. plant A is exposed to classical music using headphones attached to the soil. ...
Wednesday, September 10, 2014 at 7:14pm

For each of these properties, give an example of how water’s properties affect life on earth. Able to dissolve salt or sugar • unable to dissolve oil • high surface tension (cohesion) • capillary action (cohesion + adhesion) • liquid more dense than ...
Tuesday, September 9, 2014 at 6:17pm

In DNA bases, CG is one pair and AT is another pair because the double ring bonds with the single ring. Why can't Guanine bond with Thymine?
Tuesday, September 9, 2014 at 4:13pm

In DNA bases, CG is one pair and AT is another pair because the double ring bonds with the single ring. Why can't Guanine bond with Thymine?
Tuesday, September 9, 2014 at 1:10pm

17.Which one of the following statements is true regarding voluntary and involuntary responses? A.Voluntary responses control the activity of glands. B.Involuntary responses are part of the autonomic system. C.Voluntary responses originate in the sensory receptors. D....
Tuesday, September 9, 2014 at 12:50pm

Biology please help!
Is respiratory control more sensitive to small changes in arterial PO2 or in arterial PCO2
Monday, September 8, 2014 at 8:25pm

Is respiratory control more sensitive to small changes in arterial PO2 or in arterial PCO2?
Monday, September 8, 2014 at 7:22pm

Biology - very urgent
Is respiratory control more sensitive to small changes in arterial PO2 or in arterial PCO2?
Monday, September 8, 2014 at 6:14pm

What happens to arterial PO2, PCO2, and H+ concentration during moderate excercise? How and why does this stimulate an increase in breathing rate?
Monday, September 8, 2014 at 5:22pm

Is respiratory control sensitive to small changes in arterial PO2 or in arterial PCO2?
Monday, September 8, 2014 at 5:18pm

I have tried to look this up but can't find it... The basal metabolism rate can be measured by calculating the amounts of _______________ and ______________. (1 point) nitrogen and carbon dioxide nitrogen and oxygen oxygen and carbon dioxide - my guess oxygen and methane
Monday, September 8, 2014 at 12:01pm

Biology Help
Enzymes: a. increase the amount of energy release in a reaction b. decrease the amount of energy release in a reaction c. catalyze only redox reactions d. reduce the activation energy needed to for a reaction I think its d. or a. Help Please
Monday, September 8, 2014 at 12:17am

Q: Analyze an experiment in which one group of plants receive extra fertilizer and another group receives extra water. Is the experiment controlled or uncontrolled? Support your answer. My answer: The experiment is uncontrolled because there is no experiment used for ...
Sunday, September 7, 2014 at 5:25pm

Gr 11 Biology
if you were a snoker, what lung volumes (tidal volume, expiratory reserve volume or vital capacity) would be most affected? i think the answer would be the expiratory reserve volume
Sunday, September 7, 2014 at 11:24am

Gr 11 Biology
Which person do you think would be more physically fit: a) an individual with a normal expiratory reserve volume and high vital capacity OR B)an individual with a high expiratory reserve volume and normal vital capacity
Sunday, September 7, 2014 at 10:51am

How is type 1 diabetes mellitus similar to starvation?
Friday, September 5, 2014 at 7:39pm

how does light affect anthocyanins?
Friday, September 5, 2014 at 2:29pm

How could you explain this statement "An ecosystem is constantly changing ,yet it remains the same."
Wednesday, September 3, 2014 at 11:53pm

1. How many seconds do you spend in school during the week (6.5 hours/day)? 2. How many micrograms are in 12 dekagrams? 3. How many centimeters are in 5 kilometers? 4. 3.25 liters are equal to how many kiloliters? 5. how man meters are in 0.65 hectometers? 6. How many grams ...
Wednesday, September 3, 2014 at 10:08pm

Suppose that a person inherited an allele of HGD from their father that had the proline 230 to serine mutation and also inherited an allele of HGD from their mother that had the glutamic acid 42 to alanine mutation. What would be that individual’s phenotype? Choose the ...
Wednesday, September 3, 2014 at 4:16pm

You have a stock solution that is 350g/L . You perform a 9-fold serial dilution four times. What concentrations will you have in each of your diluted tubes in g/L? (Separate your answers with a comma.)
Tuesday, September 2, 2014 at 9:45pm

PCSK9, a protease that regulates the level of LDL receptors, is a new target for lowering circulating levels of LDL. Excess PCSK9 leads to a decrease in LDL receptor levels. Which one of the following tools would you use in mice to model a potential therapy for humans with ...
Tuesday, September 2, 2014 at 12:25pm

What are two traits of an information source that may indicate the information given is scientifically unreliable? Answer: peer review does not necessarily indicate that the other field expert reviews are in agreement with conclusions of the original writer, and a well ...
Thursday, August 28, 2014 at 7:10am

What are two traits of an information source that may indicate the information given is scientifically unreliable? Answer: peer review does not necessarily indicate that the other field expert reviews are in agreement with conclusions of the original writer, and a well ...
Wednesday, August 27, 2014 at 11:56pm

In a controlled experiment, a scientist is studying how long it takes pea plants growing in different soil types to develop flower buds. What is the manipulated independent variable? a) type of soil used b) number of flower buds produced c) how long it takes for flower buds to...
Wednesday, August 27, 2014 at 9:06pm

Why are most factors held constant in a scientific experiment? Answer: the only part of an experiment that ever changes is the independent variable.
Wednesday, August 27, 2014 at 8:36pm

What is a written observation called? Answer: hypothesis
Wednesday, August 27, 2014 at 8:30pm

Is yeast living, nonliving, or dead? Explain why.
Tuesday, August 26, 2014 at 6:42pm

Compare and contrast the structure and function of a compound light microscope and a scanning electron microscope. Be sure to discuss the structure and function of each as well as the function and usefulness of each when examining a specimen. Please help! I just need help ...
Tuesday, August 26, 2014 at 3:02pm

How would you describe the role that observations and inferences play in the scientific process?
Monday, August 25, 2014 at 6:42pm

Monday, August 25, 2014 at 6:33am

Explain how both nucleic acids and proteins are polymers.Be sure to describe the monomers that make up the polymers.
Thursday, August 21, 2014 at 10:27pm

You want to design an experiment to test if a bacteria affects a transmembrane protein. What types of controls should you use to eliminate effects of confounding variables?
Thursday, August 21, 2014 at 8:49pm

Is this correct? 2 examples of reproduction is a starfish and a rose bush....
Tuesday, August 19, 2014 at 11:56pm

What are two examples of cellular organization.. Plz help Google sucks 😂
Tuesday, August 19, 2014 at 11:24pm

Justin wants to be the captain of an aircraft carrier when he gets out of school. Which subjects should Justin study to help him prepare for his career? A.biomedical science and meteorology B.oceanography and paleontology C.chemistry and biology D.physics and computer science ...
Tuesday, August 19, 2014 at 2:08pm

Which branches of science do pharmacists need knowledge of to do their job properly? A.physics and chemistry B.biology and chemistry C.chemistry and geology D.physics and computer science Is the answer B?
Tuesday, August 19, 2014 at 1:59pm

You are testing the injection of a new chemical on mice to see if it can shrink tumors. To properly administer the chemical, it must be dissolved in water with ascorbic acid (vitamin C) and injected into the middle of a tumor. As a positive control, you plan to similarly ...
Tuesday, August 19, 2014 at 12:18am

While performing an experiment, a positive control group is given a treatment that was used one time previously in another experiment. This time, however, the positive control does not give the expected result that you received last time. Which of the following is a likely ...
Tuesday, August 19, 2014 at 12:11am

You want to know if a new species of bacteria we identified (E. glados) has resistance to the antibiotic valinomycin. You make “plates” of LB-agar to culture bacteria on. Some of these are regular LB-agar plates that any bacteria will grow on and others have ...
Monday, August 18, 2014 at 11:56pm

A "tree of life" explains: a. how organisms are related to each other b. how organisms differ from each other c. the lineages of various organisms. d. All of the above
Monday, August 18, 2014 at 8:50pm

Reptiles do not live in the Arctic; however, some birds do, even though they evolved from reptiles. In your own words, offer an explanation for this fact. Include information on the metabolic differences between the two groups' bodies, as well as what effect their ...
Monday, August 18, 2014 at 12:46pm

state three secondary functions of roots,stems and leaves
Sunday, August 17, 2014 at 6:32pm

A reference calls for the use of "one litre of 0.1 molar acetate buffer pH 5.2” Calculate the amounts of sodium acetate and acetic acid required to make up this buffer, given that for acetic acid Ka = 1.8 x 10-5
Saturday, August 16, 2014 at 6:36am

during the downpour in a village,the rainwater carried away excess of nitrogenous and other compounds present in the soil to a will they affect the growth of algae and phyloplankton in the pond?
Thursday, August 14, 2014 at 7:47am

Biology: Genetics
18.Which of these is trueof meiosis? A. n → 2n B. n → n C. 2n → n D. 2n → 2n Is it C.?
Wednesday, August 13, 2014 at 12:34pm

Biology: Genetics
18.Which of these is true of meiosis? A. n → 2n B. n → n C. 2n → n D. 2n → 2n Is C. the right aswer?
Wednesday, August 13, 2014 at 12:30pm

Diagram the genotypes of the P1 pea plants from the previous four questions by placing the correct answer on its correct place.
Tuesday, August 12, 2014 at 3:01pm

In a high school, 30% of student take physics, 15% of students take chemistry. The rest of students are taking biology. What is minimum student taking biology? A.7 B.8 C.9 D.10 E.11
Sunday, August 10, 2014 at 4:20pm

Suppose that a repressor regulated the expression of the galA gene. Which of the parenthesis would be correct? (((supposing hypothetical bacterium gene: "galA" – encodes an enzyme that is required for cells to digest the sugar galactose/and/ "argB" &#...
Saturday, August 9, 2014 at 11:06am

Should the point (0,0) be plotted on this graph? Average Temperatures in Degrees F. (1)Jan 52 (2)Feb 57 (3)Mar 65 (4)Apr 73 (5)May 80 (6)June 87 (7)July 89 (8)Aug 88 (9)Sept 82 (10)Oct 73 (11)Nov 63 (12)Dec 55 This data represents a repeating cycle. Should the point (0,0) be ...
Thursday, August 7, 2014 at 5:19pm

molecular biology
To confirm that the recombinant plasmids obtained were exactly what you wanted, you need to determine the DNA sequence of the PCR products found in several of the recombinant plasmids. To do this, you use the primer 5'-CACG-3'. You carry out a set of four dideoxy ...
Thursday, August 7, 2014 at 6:44am

If a microscope has a 40× objective lens in place and a 15× eyepiece lens, the magnification of the system under these conditions is
Wednesday, August 6, 2014 at 2:47pm

doing a biology project and they want us to figure out how long it takes to cook 6 different foods at 5 different temperatures and gather 30 seperate data points. They want us to identify an x(independent) and a y(dependent) variable that can be recorded on a table. Would x be...
Wednesday, August 6, 2014 at 8:33am

doing a biology project and they want us to figure out how long it takes to cook 6 different foods at 5 different temperatures and gather 30 seperate data points. They want us to identify an x(independent) and a y(dependent) variable that can be recorded on a table. Would x be...
Tuesday, August 5, 2014 at 7:17pm

so i have this 5-3 gene sequence and i need to transcribe it to a polypeptide and im not sure my trascription is right could someone check gene sequence(ACCTGATGGCCGTTAATCTATTTAAGGCCTG​AAGTAACGTATGG) trans(ThrTrpProLeuIleTyrLeuArgProGluValT​hrTyr)
Tuesday, August 5, 2014 at 11:52am

5’-CGCACCTGTGTTGATCACCTAGCCGATCCACG​GTGGATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGC​CACCTAGGTTCCG-5’ Tip: If you want to see a review of PCR, we recommend this amazing animation and ...
Monday, August 4, 2014 at 3:45pm

5’-CGCACCTGTGTTGATCACCTAGCCGATCCACG​GTGGATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGC​CACCTAGGTTCCG-5’ Tip: If you want to see a review of PCR, we recommend this amazing animation and ...
Monday, August 4, 2014 at 3:45pm

Consider the following 45 base-pair (bp) DNA sequence: 1 10 20 30 40 | . | . | . | . | . 5’-CGCACCTGTGTTGATCACCTAGCCGATCCACG​GTGGATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGC​CACCTAGGTTCCG-5&#...
Monday, August 4, 2014 at 3:43pm

Which of the following is the purpose of the waxy substance that builds up in the ear canal? A. Insulating the ear canal B. Trapping and removing debris C. Promoting sound conduction D. Cushioning and stabilizing the pinna I thinks it is B
Wednesday, July 30, 2014 at 12:57pm

biology, molecular
Consider the following 45 base-pair (bp) DNA sequence: 1 10 20 30 40 | . | . | . | . | . 5’-CGCACCTGTGTTGATCACCTAGCCGATCCACG​GTGGATCCAAGGC-3’ ||||||||||||||||||||||||||||||||||||||||​||||| 3’-GCGTGGACACAACTAGTGGATCGGCTAGGTGC​CACCTAGGTTCCG-5&#...
Wednesday, July 30, 2014 at 11:09am

A scientist has noted a possible relationship between a certain chemical substance found in fish and the occurrence of kidney failure in humans. Which of the following preliminary steps should the scientist take before conducting a controlled experiment? A. Establish a cause ...
Sunday, July 27, 2014 at 5:04pm

Which of the following will happen if mRNA fails to be translated? A The cell's nucleus will produce more chromatin. B. Ribosomes will not be able to create protein. C. Mitochondria will release ATP. D. The cell will produce more mRNA I think it's B
Sunday, July 27, 2014 at 5:00pm

Which of the following classes of biomolecules are frequently responsible for bringing about cell differentiation? A Transcription factors B. lnterleukins C. Cytokines D. Nucleotidyl transferases I think it's A
Sunday, July 27, 2014 at 4:58pm

Which of the following is the purpose of valves in the venous circulatory system? A. Promoting movement of oxygenated blood toward the heart B. Facilitating stasis of blood in the veins C. Propelling blood through the vena cava D. Preventing backward flow of deoxygenated blood...
Sunday, July 27, 2014 at 4:58pm

In an experiment, a researcher counts the number of oxygen bubbles produced by water plants placed under different colors of light. The researcher finds that water plants placed under white light release more oxygen bubbles than water plants placed under red light. Which of ...
Sunday, July 27, 2014 at 4:57pm

A researcher collects high-resolution photographs of the Earth taken from outer space at annual intervals for the last decade. This data would be most useful to analyze which of the following? A. Human movement during crises B. Migration patterns of large whales C. ...
Saturday, July 26, 2014 at 3:23pm

Mutations during which of the following processes in animals will affect offspring of succeeding generations? A Meiosis B. Mitosis C. Translation D. Transcription I think A!
Thursday, July 24, 2014 at 3:17pm

Biology/ a&p
Which of the following parts of the circulatory system carries oxygenated blood? A. An artery moving blood from the heart to the lungs B. A vein moving blood to the heart from the body C. An artery moving blood from the heart to a muscle cell D. A venule moving blood to the ...
Thursday, July 24, 2014 at 3:02pm

Which of the following represents Boyle's gas law? A. Gas turns to a liquid when temperature reaches 0° C (32° F). B. As the volume of a gas increases, the temperature also increases. C. At any temperature, inert gases are less combustible than non-inert gases. D. ...
Thursday, July 24, 2014 at 10:49am

Which of the following processes produces haploid gametes? A. Meiosis B. Fertilization C. Mitosis D. In!@#$%^&tion I think A
Wednesday, July 23, 2014 at 9:23pm

6. If each of eight biology classrooms is in use for 5 hours and 15 minutes per day, and total of 84 student experiments are done, how long does each experiment take on average? A.20 minutes B.30 minutes C. 40 minutes D.50 minutes E.1 hour please show work.
Wednesday, July 23, 2014 at 7:33pm

1. Giraffes have long necks that allow them to reach more food sources in their habitat. The long neck trait is an example of A. selection. B. adaptation. C. radiation. D. homology. 2. Which of the following is the most common kind of chemical bond in biological molecules? A. ...
Wednesday, July 23, 2014 at 6:54pm

Is emulsification chemical or mechanical?
Wednesday, July 23, 2014 at 2:59am

Which of the following is the balanced equation for photosynthesis in plant cells? A 3C0+ 3H0 + Energy --)-CH120 + 30 2 266 2 B. 6C0+ 6Hp + Energy--)-CHp + 60 2 616 2 C. CH0 + 30--)-3C0+ 3H0 + Energy 6126 2 2 2 D. CHp + 60--)-6C0+ 6Hp + Energy 616 2 2 I really do not know
Monday, July 14, 2014 at 7:30pm

. Which of the following parts of the circulatory system carries oxygenated blood? A An artery moving blood from the heart to the lungs B. A vein moving blood to the heart from the body C. An artery moving blood from the heart to a muscle cell D. A venule moving blood to the ...
Monday, July 14, 2014 at 7:27pm

. The covalent bonds between the monomers of an enzyme macromolecule are A. glycosidic bonds. B. peptide bonds. C. phosphodiester bonds. D. ester bonds. I thimk it is B
Sunday, July 13, 2014 at 3:47pm

. Which of the following is the term given to the sequence of nucleotides that contains the information to make a specific protein molecule? A. Promoter B. Gene C. Operator D. Locus I thinh it is B.
Sunday, July 13, 2014 at 3:25pm

Plant -+ Deer --+ Tiger The first step in the energy chain that created the bonds of proteins in the tiger's muscle cells in the food chain shown above is the A. deer the tiger ate. B. plant the deer ate. C. photons the sun made. D. carbohydrates the plant made. I think it...
Sunday, July 13, 2014 at 12:10pm

Which of the following terms describes changes in allele frequencies in the gene pool over a single generation? A. Macroevolution B. Microevolution C. Segregation D. Speciation
Sunday, July 13, 2014 at 11:43am

. Which of the following is an appropriate description of the arrangement of the cell membrane? A. Fluid phospholipid bilayer containing embedded proteins B. Rigid carbohydrate bilayer containing embedded phospholipids C. Rigid layer of phospholipids with proteins on the outer...
Sunday, July 13, 2014 at 11:38am

  1. Pages:
  2. <<Prev
  3. 1
  4. 2
  5. 3
  6. 4
  7. 5
  8. 6
  9. 7
  10. 8
  11. 9
  12. 10
  13. 11
  14. 12
  15. 13
  16. 14
  17. 15
  18. Next>>

Homework Help: Science
